We narrowed to 13,184 results for: BASE
-
Plasmid#222501PurposeExpresses EFS promoter driven human codon optimized SpdCas9 directly fused to Dnmt3A/3L variant catΔ (C706A and R832E) followed by P2A-mCherryDepositorInsertS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L variant catΔ (C706A and R832E) engineered fusion
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9; C706A and R832…PromoterEFSAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-SpdCas9-Dnmt3A/3L-WT
Plasmid#222502PurposeExpresses TRE3GV promoter driven human codon optimized SpdCas9 directly fused to WT Dnmt3A/3L and hPGK promoter driven mCherryDepositorInsertsS. pyogenes dCas9 with C-terminal fusion of murine Dnmt3A-Dnmt3L engineered fusion
mCherry
UseLentiviralTagsFLAG TagExpressionMammalianMutationD10A and H840A in S.pyogenes Cas9PromoterTRE3GV and hPGKAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOGS539_rPD-L1nb
Plasmid#226717PurposePlasmid enabling yeast-mediated expression and secretion of recombinant PD-L1 nanobody (rPD-L1nb)DepositorInsertRecombinant PD-L1 nanobody
TagsHA tag, Histidine tag, and Mating factor alpha se…ExpressionYeastPromoterpTEF1Available SinceDec. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-nSpCas9-TadA8.20m
Plasmid#209045PurposeLentiviral vector expressing doxycycline-inducible human codon-optimized adenine base editor where TadA8.20m is fused to the N-terminus of SpCas9(D10A)-6xNLSDepositorInsertTadA8.20m-nSpCas9
UseCRISPR and LentiviralTagsFLAG-HAExpressionMammalianMutationD10APromoterTight TRE promoterAvailable SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAC-C Sars-CoV-2 NSP12_P314L
Plasmid#194813PurposeSars-CoV-2 NSP12_P314L in MAC-C destination vectorDepositorAvailable SinceMay 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCMV_SEPT9_i1-14-GFP10
Plasmid#180343Purposemammalian expression of human SEPT9_i1 fused to GFP10DepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
HT116_pAAV_hSyn-DiO-SomQuasAr6b_EGFP
Plasmid#190879PurposeCre-on expression of soma-targeted QuasAr6b under an neuronal promoterDepositorInsertsoma-targeted QuasAr6b
UseAAVTagsEGFPPromoterhSynAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
MKV937/nlp-1p::FlincG3
Plasmid#140508PurposeThis construct contains cGMP biosensor driven by nlp-1 promoter for expression in PHB sensory neuron in pSMdelta backbone.DepositorInsertFlincG3
ExpressionWormPromoternlp-1Available SinceMay 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ255
Plasmid#124310PurposeGateway entry vector with rAPOBEC1 and pcoCas9D10A for C-T base editingDepositorInsertrAPOBEC1-pcoCas9D10A-UGI
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ255-x3.7
Plasmid#124311PurposeGateway entry vector with rAPOBEC1 and pcoCas9D10A-x3.7 for C-T base editingDepositorInsertrAPOBEC1-pcoCas9D10A_x3.7-UGI
UseCRISPRAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYPQ256-x3.7
Plasmid#124313PurposeGateway entry vector with PmCDA1 and pcoCas9D10A-x3.7 for C-T base editingDepositorInsertpcoCas9D10A_x3.7-PmCDA1-UGI
UseCRISPRAvailable SinceMay 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-hAsCas12a-RVR(S542R/K548V/N552R)-NLS(nucleoplasmin)-3xHA (AAS1065)
Plasmid#114092PurposeCAG promoter expression plasmid for human codon optimized AsCas12a-RVR(S542R/K548V/N552R) nuclease with C-terminal NLS and HA tagDepositorInserthuman codon optimized AsCas12a (S542R/K548V/N552R)
TagsNLS(nucleoplasmin) and 3xHAExpressionMammalianMutationS542R, K548V and N552RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-hAsCas12a(E174R/S542R)-NLS(nucleoplasmin)-6xHis (AAS1880)
Plasmid#114071PurposeT7 promoter bacterial expression plasmid for human codon optimized AsCas12a(E174R/S542R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized AsCas12a (E174R/S542R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationE174R and S542RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-gap_RiboJ_GFP+_MGApt_Bba_B0015
Plasmid#107577PurposeB. megaterium DSM319 gap promoter, GFP+ with malachite green mRNA aptamer for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertGFP+
UseSynthetic Biology; E. coli and bacillus shuttle v…TagsB. megaterium DSM319 xylA leader sequence (MTSSKI…ExpressionBacterialMutationF64L/ S65T/ Q80R/ F99S/ M153T/ V163APromotergapdh promoter - B. megaterium DSM319Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
(P4)RBSS1
Plasmid#251376PurposeSynthetic RBS based on Synechocystis ribosome 30S anti-SDDepositorInsertRBS S1
ExpressionBacterialAvailable SinceMarch 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
(P6)RBSS1
Plasmid#251386PurposeSynthetic RBS based on Synechocystis ribosome 30S anti-SDDepositorInsertRBS S1
ExpressionBacterialAvailable SinceMarch 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
(P2)RBSS1
Plasmid#251366PurposeSynthetic RBS based on Synechocystis ribosome 30S anti-SDDepositorInsertRBS S1
ExpressionBacterialAvailable SinceMarch 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
m.3047-Left TALE-G1397-N-dead-mCherry
Plasmid#211339PurposeExpression of codon-optimized dead mitochondrial base editor in human cells; cell sorting; blasticidin drug selectionDepositorInsertm.3047-Left TALE-G1397-N-dead-mCherry
UseTALENExpressionMammalianPromoterCMVAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
m.3075-Left TALE-G1397-N-dead-mCherry
Plasmid#211340PurposeExpression of codon-optimized dead mitochondrial base editor in human cells; cell sorting; blasticidin drug selectionDepositorInsertm.3075-Left TALE-G1397-N-dead-mCherry
UseTALENExpressionMammalianPromoterCMVAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only