173,520 results
-
Plasmid#143785PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pPTDH
Plasmid#66183PurposeExpresses phosphite dehydrogenase in E. coliDepositorInsertPhosphite Dehydrogenase
TagsHis6 tagExpressionBacterialMutationE175A, A176RPromoterT7 promoterAvailable SinceJune 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28a-6xHis-MBP-TEV site-TadA8.20
Plasmid#194702PurposeExpresses N-terminal MBP fused TadA8.20 in bacteriaDepositorInsertTadA8.20
Tags6xHis and MBPExpressionBacterialMutationmutations in TadA are described in the paperPromoterT7 promoterAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-myc-EphB4
Plasmid#200983PurposeMammalian expression plasmid for myc-tagged EphB4DepositorInsertEphB4 (EPHB4 Human)
TagsExtracellular c-myc epitope tag and Signal peptid…ExpressionMammalianPromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCMV_HyPer7RgDAAO
Plasmid#217653PurposeExpresses the fusion of HyPer7,a H2O2 sensor, and Rhodotorula gracilis D amino acid oxidase (DAAO) to measure transport of D amino acids across the plasma membraneDepositorInsertHyPer7 D amino acid oxidase
UseLentiviralTagsNuclear export signalExpressionMammalianMutationFused DAAO to the C-terminus of HyPer7 using a Gl…PromoterCMVAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T3-GST-Tev
Plasmid#177142PurposeBacterial vector for expression of an N-terminal GST fusion of the Tev proteaseDepositorInsertTev
TagsGSTExpressionBacterialPromoterTacAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-iPEmax-Hygro
Plasmid#214020Purposeinducible PEmax system for controllable prime editing; this plasmid is used to insert PEmax prime editor in one allele of AAVS1 locusDepositorInsertPEmax
ExpressionMammalianPromoterTRE-tightAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET21-pelB-LaM-4
Plasmid#172770PurposeBacterial expression of anti-mCherry nanobody LaM-4, with pelB leader and C-term free cysteine and 6xHIS tag.DepositorInsertLaM-4
Tags6xHIS and pelB leader for periplasmic secretionExpressionBacterialPromoterT7Available SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
U6-BbsI-GGsite-mCherry-Puro
Plasmid#221232PurposeCloning vector for sgRNA with mCherry and PuroDepositorTypeEmpty backboneExpressionMammalianAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMIIS793
Plasmid#238206PurposeExpresses TaTasR with an N-terminal Twin-Strep-SUMO tag. KanRDepositorInsertTaTasR
TagsTwinStrepII-bdSUMOExpressionBacterialAvailable SinceMay 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
mPapaya-pBAD
Plasmid#54838PurposeLocalization: Protein Expression Vector , Excitation: 530, Emission: 541DepositorTypeEmpty backboneTags6xHis and mPapayaExpressionBacterialAvailable SinceJuly 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pOZ-FH-C-puro
Plasmid#32516DepositorTypeEmpty backboneUseRetroviralTagsFLAG and HAExpressionMammalianAvailable SinceSept. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-enCas9-PolI3M-TBD
Plasmid#113077PurposeExpresses enCas9 fused to PolI3M-TBD in E. coli. contains a BsmbI-flanked GFP cassette for sgRNA cloning.DepositorInsertenCas9-PolI3M-TBD
ExpressionBacterialAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-CDS
Plasmid#136039PurposeG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HA-hIFITM3
Plasmid#58397PurposeExpressed human IFITM3 with an N-terminal HA tag in mammalian cellsDepositorAvailable SinceSept. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-gamma-TuSC
Plasmid#178079PurposeInsect cell expression of gamma-TuSCDepositorTagsTEV-His6ExpressionInsectAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-ERK2-L4A-MEK1_fusion
Plasmid#39197DepositorTagsMycExpressionMammalianMutationL4A = L33A, L37A, L40A, L42APromoterCMVAvailable SinceJuly 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.4_1G11F2-3 heavy chain
Plasmid#198253Purposerecombinant expression of heavy chain of monoclonal anti-AMP antibody 1G11F2-3DepositorInsertheavy chain of monoclonal anti-AMP antibody 1G11F2-3 (mouse IgG2b)
TagsIL10 signal peptideExpressionMammalianPromoterCMVAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBa-LSS-GFP-LDLR wt
Plasmid#98184PurposeLow Density Lipoprotein Receptor N-terminally tagged with Green Fluorescent Protein. LSS= LDLR signal sequence, which is cleaved leaving the GFP attached to the mature LDLR protien.DepositorInsertLDLR (LDLR Human)
TagsGFP and LDLR signal sequence, N-term of GFP so GF…ExpressionMammalianMutationnonePromoterChicken Beta ActinAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHRi_1G4 hTCRβ-SNAP
Plasmid#187604PurposeLentiviral expression of hTCR beta(1G4), and SNAP for low expressionDepositorAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only