We narrowed to 9,707 results for: crispr plasmids
-
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMM756
Plasmid#133600PurposePart Plasmid for ERG25 sgRNA, Part 234(promoter,coding region, terminator)DepositorInsertsgERG25
UseSynthetic BiologyAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM755
Plasmid#133599PurposePart Plasmid for ERG11 sgRNA, Part 234(promoter,coding region, terminator)DepositorInsertsgERG11
UseSynthetic BiologyAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMM764
Plasmid#133601PurposePart Plasmid for TEF1 sgRNA, Part 234(promoter,coding region, terminator)DepositorInsertsgTEF1
UseSynthetic BiologyAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pJ2077.2
Plasmid#140666PurposeController plasmid for TS circuit and cL and cR controlsDepositorInsertController plasmid for TS circuit and cL and cR controls
UseSynthetic BiologyExpressionBacterialAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
mLama1 AAV sgRNA 1, 2, 5
Plasmid#135339PurposeExpression plasmid of VP64-SadCas9 sgRNA 1, 2 and 3DepositorInsertLama1 VP64-dCas9 sgRNA Guides
UseAAVTagsEGFPExpressionMammalianPromoterCMVAvailable SinceMarch 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
LF701: pMAGIC (L1-R5) hU6::xCas9(3.7) gRNA scaffold
Plasmid#121817PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven xCas9(3.7) (i.e. SpCas9) gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KZ801: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold; EF1a promoter
Plasmid#121814PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and EF1a promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LG002: pMAGIC (L1-R5) mU6::xCas9(3.7) gRNA scaffold
Plasmid#121816PurposepMAGIC L1-R5 entry plasmid, contains empty mouse U6-driven xCas9(3.7) (i.e. SpCas9) gRNA scaffold for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
Cas9_YTHDF2_sgRNA
Plasmid#186673PurposeYTHDF2 sgRNA plasmidDepositorInsertYTHDF2 KO sgRNA Plasmid (YTHDF2 Human)
ExpressionMammalianAvailable SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
KB501: pMAGIC (L1-R5) hU6::SaCas9 gRNA scaffold; CMV promoter
Plasmid#121813PurposepMAGIC L1-R5 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and CMV promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestion.DepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
KB601: pMAGIC (L5-L4) hU6::SaCas9 gRNA scaffold; EF1a promoter
Plasmid#121819PurposepMAGIC L5-L4 entry plasmid, contains empty human U6-driven SaCas9 gRNA scaffold and EF1a promoter for 4-component MultiSite Gateway Pro assembly. Protospacer motif can be inserted after BsaI digestionDepositorTypeEmpty backboneUseSynthetic Biology; Pmagic gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-scFVDnmt3L_bGHpA
Plasmid#177350PurposeAAV expression of scFV-fused C terminal domain of Dnmt3l for targeted DNA methylation editingDepositorInsertC-terminal domain of mouse Dnmt3l (Dnmt3l Mouse)
UseAAVTagsmyc and scFVExpressionMammalianMutation194–415 aaPromoterCMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-scFVtet2_bGHpA
Plasmid#177352PurposeAAV expression of scFV-fused catalytic domain of TET2 for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 2 (TET2 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationCatalytic domains of human TET2 (1129–1936 and 14…PromoterCMV promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-scFVtet2_bGHpA
Plasmid#177353PurposeAAV expression of scFV-fused catalytic domain of TET2 from Synapisin promoter for targeted DNA methylation editingDepositorInsertTet Methylcytosine Dioxygenase 2 (TET2 Human)
UseAAVTagsmyc and scFVExpressionMammalianMutationCatalytic domains of human TET2 (1129–1936 and 14…Promoterhuman Synapsine promoterAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only