We narrowed to 15,978 results for: grna
-
-
-
-
-
-
-
-
-
-
-
-
pTHAP12-N1.1.2-gDNA
Plasmid#175860PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertTHAP12-Nickase2
UseCRISPRAvailable SinceOct. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCHCHD3-N2.1.2-gDNA
Plasmid#175858PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertCHCHD3-Nickase2
UseCRISPRAvailable SinceOct. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCHCHD3-N1.1.1-gDNA
Plasmid#175857PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertCHCHD3-Nickase1
UseCRISPRAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP9
Plasmid#166111PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets the C-terminus of Hta2DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZNF668.1.0-gDNA
Plasmid#132463PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF668 (ZNF668 Human)
UseCRISPRAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCENPBD1.1.0-gDNA
Plasmid#132460PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertCENPBD1 (CENPBD1 Human)
UseCRISPRAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTHAP7.1.0-gDNA
Plasmid#132439PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertTHAP7 (THAP7 Human)
UseCRISPRAvailable SinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 neo
Plasmid#13425Purpose3rd gen lentiviral backbone for cloning and expression of new shRNA sequences. Uses neomycin for selection.DepositorInsertnon-hairpin 18bp
UseLentiviral and RNAiExpressionMammalianPromoterU6 promoterAvailable SinceDec. 22, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1A
Plasmid#185382PurposeFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only