We narrowed to 15,613 results for: grna
-
Plasmid#119132PurposegRNA that guides Cas9 and APOBEC complexes to L202 in eGFP.DepositorInserteGFP L202 gRNA
UseCRISPRMutationNonePromoterU6Available SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJA59
Plasmid#59932PurposegRNA for cleavage at unc-109(n499) locus in C elegansDepositorInsertunc-109(n499) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pADH100-2
Plasmid#90981PurposeNAT-marked C. albicans ADE2-specific gRNA expression construct; part 2 of 2 of C.alb HIS1-FLP CRISPR system. Use with pADH99 CAS9 expression construct.DepositorInsertNAT 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, FRT, DS_HIS1
UseCRISPRAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMEL13
Plasmid#107919Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_GFP_AAVS1_186
Plasmid#159091Purposetargeting, non-essential locus controlDepositorInsertgRNA
UseLentiviralExpressionMammalianAvailable SinceJan. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_mCherry_AAVS1_1801
Plasmid#159090Purposetargeting, non-essential locus controlDepositorInsertgRNA
UseLentiviralExpressionMammalianAvailable SinceDec. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_GFP_AAVS1
Plasmid#141211PurposepDECKO_GFP_AAVS1_1801. Targeting, non-essential locus controlDepositorInsertgRNA
UseLentiviralExpressionMammalianAvailable SinceJuly 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGTPA-lb
Plasmid#171528PurposePlasmid contains the Cas12k gRNA for mutant library constructionDepositorInsertCas12k gRNA
UseCRISPRPromoterConstitutive promoter J23119Available SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCBE-dGFP-gRNA
Plasmid#226862PurposeHuman gRNA expression vector targeting the Y93H mutation of non-fluorescent EGFP in plasmid pCBE-dGFP; for use with CBEsDepositorInsertSp-gRNA
ExpressionMammalianPromoterhU6Available SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC19-sgNCF1
Plasmid#190193PurposeExpresses a gRNA for base editing the Kozak sequence of the human NCF1 geneDepositorInsertgRNA sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLdCN2
Plasmid#125186PurposeExpresses Streptococcus pyogenes Cas9 (SpCas9) and two gRNAs in LeishmaniaDepositorInsertgRNA and Cas9
UseCRISPR; LeishmaniaAvailable SinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCB094 FoMV-sgLw
Plasmid#234816PurposeTo express guide gRNA from Foxtail Mosaic Virus Vector targeting SbLw (T-DNA)DepositorInsertgRNA targeting SbLw
ExpressionPlantAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCB092 FoMV-sgMgCh
Plasmid#234815PurposeTo express guide gRNA from Foxtail Mosaic Virus Vector targeting SbMgCh (T-DNA)DepositorInsertgRNA targeting SbMgCh
ExpressionPlantAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pM355
Plasmid#173175Purpose(Empty Backbone) Expresses gRNA-12xMBS from hU6 promoterDepositorInsertgRNA-12xMBS backbone
UseCRISPRExpressionMammalianPromoterhU6Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP12-AAV-H1/TO-L-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82704PurposeAAV backbone with a full length H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl sites. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO-L Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMEL12
Plasmid#107918Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
STAGR_gRNAScaffold_hU6
Plasmid#102840PurposeCan be used as PCR template for a STAgR reactionDepositorInsertgRNAScaffold_hU6promoter
PromoterhU6Available SinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-sg-1
Plasmid#190607PurposeExpresses a gRNA for base editing the EGFP Kozak sequence of pWPT-/mEGFP-1T-IRES-mCherryDepositorInsertgRNA sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOTTC763 - pX458 with rat Rosa26 gRNA A
Plasmid#113161PurposeA plasmid that expresses a guide RNA targeting rat Rosa26 as well as FLAG-tagged SpCas9 and GFPDepositorInsertgRNA for rat Rosa26
UseCRISPRExpressionMammalianPromoterhU6Available SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only