We narrowed to 15,000 results for: GRN
-
Plasmid#184919PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_hph recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPten#2/Cre
Plasmid#173646PurposeExpresses a Pten-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Pten (Pten Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgEp300#1/Cre
Plasmid#173591PurposeExpresses a Ep300-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Ep300 (Ep300 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTp53#2/Cre
Plasmid#173621PurposeExpresses a Tp53-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Tp53 (Trp53 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKmt2d#2/Cre
Plasmid#173598PurposeExpresses a Kmt2d-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Kmt2d (Kmt2d Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1-G7
Plasmid#173203PurposeExpresses the ATP1A1 G7 sgRNA in combination with FLAGless eSpCas9(1.1) to target ATP1A1 intron 17. pX330-like plasmid.DepositorInsertATP1A1 G7 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458-CCND1
Plasmid#172630PurposeExpresses a gRNA against CCND1 and Cas9 from S. pyogenes with 2A-EGFPDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Cacnb4-GFP KI
Plasmid#139663PurposeEndogenous tagging of CaVβ4: C-terminal (amino acid position: H417)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN460
Plasmid#137878PurposePiggyBac vector for expression of 1x gRNA targeting POGZ for CRISPRa;mRFP-T2A-BlasticidinRDepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pLG1-puro-sgATL3-2
Plasmid#109010PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC1orf27-1
Plasmid#86130PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C1orf27DepositorInsertsgRNA 1 targeting C1orf27 (C1orf27 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAGK111
Plasmid#228126PurposeExpress node 1531 retron with split retron ncRNA and gRNA to edit (SNIP + PAM recode) EMX1 gene in human cellsDepositorInsertRetron node 1531 split retron ncRNA and gRNA to edit EMX1 gene (SNP + PAM recode) in human cells
ExpressionMammalianPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-ARL13B
Plasmid#227276PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of ARL13B for knock-in.DepositorInsertsgRNA Targeting C-terminus of ARL13B (ARL13B Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpyB-GFP
Plasmid#220190PurposesgRNA expression vector - pBG35 promoter with GFP in sgRNA siteDepositorInsertpBG35 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpBG35Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpyC-GFP
Plasmid#220191PurposesgRNA expression vector - pBG42 promoter with GFP in sgRNA siteDepositorInsertpBG42 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpBG42Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
SaCas9v2-Puro
Plasmid#178802PurposeSaCas9 with 2A-Puro, and a cloning backbone for sgRNA.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-EF-5Nanog_2
Plasmid#174871PurposeCRISPR vector for generating Nanog STREAMING-tag KI cellDepositorInsertsgRNA for mouse Nanog (Nanog Synthetic)
UseCRISPRAvailable SinceDec. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnd3
Plasmid#159912PurposeMutagenesis of Kcnd3DepositorInsertKcnd3 (Kcnd3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only