We narrowed to 16,448 results for: GRN
-
Plasmid#173632PurposeExpresses a Cmtr2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Cmtr2 (Ftsjd1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKeap1#2/Cre
Plasmid#173640PurposeExpresses a Keap1-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Keap1 (Keap1 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgDnmt3a#1/Cre
Plasmid#173587PurposeExpresses a Dnmt3a-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Dnmt3a (Dnmt3a Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Pos
Plasmid#61857PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, positive strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Neg
Plasmid#61856PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, negative strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
Helios-CRISPR #1 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
Plasmid#75244PurposeCRISPR/Cas9 plasmid against human HeliosDepositorInsertsgRNA against human Helios (IKZF2 Human)
UseCRISPRAvailable SinceJune 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
NFATc1-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75238PurposeCRISPR/Cas9 NICKASE plasmid against human NFATc1 (1/2)DepositorInsertsgRNA against NFATc1 (NFATC1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
NFATc1-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75239PurposeCRISPR/Cas9 NICKASE plasmid against human NFATc1 (2/2)DepositorInsertsgRNA against NFATc1 (NFATC1 Human)
UseCRISPRAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-2G-CNCB_sgRBBP6-68
Plasmid#237555PurposeA piggybac-based vector containing mouse U6 promoter-driven RBBP6 sgRNA #6, human U6 promoter-driven RBBP6 sgRNA #8 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorInsertRBBP6 (RBBP6 Human)
UsePiggybacExpressionMammalianPromotermouse U6 promoter and mouse U6 promoter, human U6…Available SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic-As
Plasmid#209036PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_2-As
Plasmid#218814PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_3-As
Plasmid#218815PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_4-As
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG-HF1
Plasmid#218160PurposeThis plasmid harbors the base editor SCBE3-NG-HF1 along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-HF1
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG-Hypa
Plasmid#218161PurposeThis plasmid harbors the base editor SCBE3-NG-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N692A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAVss-U6-sgHTT51-7sk-Cas9
Plasmid#190901PurposeAAV-KamiCas9 vector expressing sgGFP and mouse HTT sgRNADepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
2X_pX458_pSpCas9(BB)-2A-GFP_eSOX17.2_KO
Plasmid#195495PurposeCas9-2A-GFP expression vector bearing two sgRNAs targeting the core endoderm distal enhancer of human SOX17DepositorAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgKmt2c#1/Cre
Plasmid#173652PurposeExpresses a Kmt2c-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Kmt2c (Kmt2c Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgTet2#2/Cre
Plasmid#173656PurposeExpresses a Tet2-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Tet2 (Tet2 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only