We narrowed to 15,910 results for: grna
-
Plasmid#124450PurposeExpresses gRNA HL1 gR4 in the pSB700 backboneDepositorInsertHL1 gR4
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_Bfl-1.1
Plasmid#85536PurposeInducible expression of guide RNA (Bfl-1.1) with fluorescent GFP reporterDepositorInsertBfl1.1
UseCRISPR and LentiviralExpressionMammalianPromoterH1tAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL193
Plasmid#180471PurposeFor expression of Cas9 and gRNAs, multiple gRNAs cloning vectorDepositorTypeEmpty backboneUseCRISPRTagsCas9ExpressionPlantAvailable sinceApril 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSDMA66
Plasmid#128355PurposegRNA ribozyme construct with Cryptococcus neoformans ACT1 promter and TRP1 terminator. Following ribozyme cleavage, a gRNA targeting ADE2 is liberated.DepositorInsertNoureothricin (NAT)
UseUnspecifiedPromoterACT1Available sinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
S13_EcoRV_UBC_AscI
Plasmid#128477PurposeUBC promoterDepositorInsertUBC promoter
ExpressionBacterialAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX459v3
Plasmid#178799PurposeSpCas9 with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available sinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB_Mut(D1399Y)_p300_core-dCas9-EGFP_hygro
Plasmid#226427PurposePiggyBac transposon vector containing a dox inducible mutant p300 core-dCas9 fusion protein (p300 core mutation: D1399Y) and EGFP reporter. Hygromycin selection marker.DepositorInsertsMutant p300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, Mutant p300 core, and P2A-EGFPExpressionMammalianMutationp300 core mutation (D1399Y)PromoterDox inducible minimal CMV and UbC PromoterAvailable sinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpec5'
Plasmid#228549PurposeTemplate for PCR amplification for gRNA cloning plasmid. The PCR product recombines in vivo with a PCR product from pSpec3', to clone gRNA plasmidDepositorInsertTruncated 5' region of aadA
UseCRISPRAvailable sinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpec3'
Plasmid#228548PurposeTemplate for PCR amplification for gRNA cloning plasmid. The PCR product recombines in vivo with a PCR product from pSpec5', to clone gRNA plasmidDepositorInsertTruncated 3' region of aadA
UseCRISPRAvailable sinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAC-U63-gRNA2.1-tub-miRFP680-T2A-HO1(HA)
Plasmid#250795PurposeDrosophila transgenic vector: nMAGIC vector with tub promoter, 3x HA tags, miRFP680, and HO1. Optimized nMAGIC vector with a far red/infra red FP marker.DepositorTypeEmpty backboneUseCRISPRExpressionInsectAvailable sinceFeb. 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6-sasgRNA(SapI)_Ple155-CI-EGFP-W3SL_BbsI(GGA)
Plasmid#231367PurposePle155-driven EGFP, also encoding U6-driven sgRNA cassette, with SapI sites to clone crRNA sequenceDepositorInsertEGFP
UseAAVAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6-sasgRNA(SapI)_Ple155-CI-mRuby2-W3SL_BbsI(GGA)
Plasmid#231368PurposePle155-driven mRuby2, also encoding U6-driven sgRNA cassette, with SapI sites to clone crRNA sequenceDepositorInsertmRuby2
UseAAVAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA
Plasmid#177360PurposeAAV expression of Chimeric guide for SaCas9 and reverse tetracycline-controlled transactivator for doxycycline controlled expression from Synapsin promoterDepositorInsertstdTomato
Chimeric guide for SaCas9
UseAAVTagsP2A and a tetracycline-controlled transactivator …ExpressionMammalianPromoterSynapsine promoter and U6 promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-TetRC-2A-Tomato-bGHpA;U6_BsaI-sgRNA
Plasmid#177365PurposeAAV expression of Chimeric guide for SaCas9 and reverse tetracycline-controlled transactivator for doxycycline controlled expressionDepositorInsertstdTomato
Chimeric guide for SaCas9
UseAAVTagsP2A and a tetracycline-controlled transactivator …ExpressionMammalianPromoterCMV and U6 promoterAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
Tol2-U6.3-sgRNA-non-targeting-control -GFP
Plasmid#221844PurposeTol2 transposon expresses control non-targeting sgRNA from chick U6.3 promoter expresses GFP reporter from GAGC promoterDepositorInsertsEGFP
non-targeting control sgRNA- GCACTGCTACGATCTACACC
UseCRISPR; Tol2 transposon optimised for chick expre…ExpressionMammalianPromoterGACG and U6.3 chickAvailable sinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-inteinC-aa713 SpG C-U6- sgRNA scaffold
Plasmid#208111PurposeExpresses SpG cas9C by the constitutive CASI promoter and sgRNA scaffold by U6 promoterDepositorInsertSpG C, U6, scaffold
UseAAVAvailable sinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-InteinC-NG C aa714-1368-U6-Lmna sgRNA1
Plasmid#206974PurposeExpresses NG cas9C by the constitutive CASI promoter and sgRNA targeting murine Lmna c.1621T mutation by U6 promoterDepositorInsertNG aa714-1368, U6, Lmna sgRNA1
UseAAVPromoterU6Available sinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1(D908A)-2A-GFP-U6-sgRNA-cloning vector
Plasmid#194726PurposeCAGGS-AsCpf1(D908A)-2A-GFP-U6-sgRNA-cloning vectorDepositorInsertAsCpf1(D908A)
UseCRISPRExpressionMammalianMutationD908AAvailable sinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNA:scaffold tetraloop MS2 aptamer SAM (GB1436)
Plasmid#160570PurposeA version of scaffold sgRNA with the sequence of MS2 aptamer inside the tetraloop of the scaffoldDepositorInsertsgRNA:scaffold tetraloop MS2 aptamer SAM
UseCRISPRMutationBsaI and BsmBI sites removedAvailable sinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-evoSpCas9 (without sgRNA; with silent mutations)
Plasmid#126758PurposeExpression plasmid for human codon-optimized increased fidelity evoSpCas9 (without U6-sgRNA coding sequence, with silent mutations)DepositorInsertevoSpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationM495V, Y515N, K526E, R661QPromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only