We narrowed to 9,895 results for: EPO
-
Plasmid#173947PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertp300 peak 1 from SOX9 enhancer cluster EC1.45
UseLuciferaseTagsExpressionMutationNonePromoterSV40 promoterAvailable SinceSept. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-20a-3p
Plasmid#103341PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-20a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-20a-3p target (MIR20A Human)
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR-ZIP(FF)
Plasmid#27135DepositorUseLentiviralTagseGFP and mCherryExpressionMammalianMutationTyrosines in ITAMS 1-3 mutated to phenylalanines …PromoterAvailable SinceApril 12, 2011AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mPELO
Plasmid#60805PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains PELO 3' UTR and mutated miR-155 sitesDepositorInsertPELO 3'UTR and mutated miR-155 binding site (PELO Human)
UseLuciferaseTagsExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mATP2B1
Plasmid#60789PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains ATP2B1 3' UTR and mutated miR-155 sitesDepositorInsertATP2B1 3'UTR and mutated miR-155 binding site (ATP2B1 Human)
UseLuciferaseTagsExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-Flag-SPRTN-Y117C
Plasmid#110216PurposeExpression in mammalian cells of of full-length SPRTN protein carrying Y117C mutation, a catalytically-impaired mutant, and Flag-tag at N-terminus.DepositorInsertSPRTN (SPRTN Human)
UseTagsFlagExpressionMammalianMutationY117C, P296L (see depositor comments below)PromoterAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Enhancer-ZC3H12D_PromoterMUT
Plasmid#153068PurposeZC3H12D promoter region carrying mutations in BHLHE40 binding sites, cloned upstream of luciferase reporterDepositorInsertZC3H12D promoter region mutated in BHLHE40 binding sites (ZC3H12D Human)
UseLuciferaseTagsExpressionMammalianMutationMutagenesis to disrupt 3 BHLHE40 binding sites. N…PromoterNoneAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL3-noSV40-mouseEC1.45
Plasmid#173972PurposeFirefly luciferase enhancer reporter plasmid.DepositorInsertMouse orthologous SOX9 enhancer cluster EC1.45
UseLuciferaseTagsExpressionMutationNonePromoterSV40 promoterAvailable SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
LIC4B-His-TEV-TAK1-TAB1
Plasmid#154874PurposeInsect cell optimized TAK1-TAB1 construct used to solve structure and deposit PDB ID: 4O91DepositorInsertTAK1-TAB1 (TAB1 Human)
UseTagsLIC TEV HisExpressionInsectMutationCodon optimizedPromoterpolyhedrinAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mINSIG2
Plasmid#60799PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains INSIG2 3' UTR and mutated miR-155 sitesDepositorInsertINSIG2 3'UTR and mutated miR-155 binding site (INSIG2 Human)
UseLuciferaseTagsExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mELOVL6
Plasmid#60791PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains ELOVL6 3' UTR and mutated miR-155 sitesDepositorInsertELOVL6 3'UTR and mutated miR-155 binding site (ELOVL6 Human)
UseLuciferaseTagsExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIS1 mLMBRD2
Plasmid#60801PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains LMBRD2 3' UTR and mutated miR-155 sitesDepositorInsertLMBRD2 3'UTR and mutated miR-155 binding site (LMBRD2 Human)
UseLuciferaseTagsExpressionMammalianMutationmutated miR-155 binding sitePromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNIC-ZB-SPRTN-Y117C-FL
Plasmid#110219PurposeExpression in E. coli of full-length SPRTN protein carrying Y112A mutation, a catalytically impaired mutant, with His and ZB tags at N-terminus.DepositorInsertSPRTN (SPRTN Human)
UseTagsHis6 and ZBExpressionBacterialMutationY117C, P296L (see depositor comments below)PromoterAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEMS1162
Plasmid#29077PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorInsertPle94 (GPR88 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSExpressionMutationPromoterAvailable SinceAug. 3, 2011AvailabilityAcademic Institutions and Nonprofits only -
pIS1 ELOVL6
Plasmid#60790PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains ELOVL6 3' UTR and wild-type miR-155 sitesDepositorInsertELOVL6 3'UTR and wild-type miR-155 binding site (ELOVL6 Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIS1 LPIN1
Plasmid#60802PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains LPIN1 3' UTR and wild-type miR-155 sitesDepositorInsertLPIN1 3'UTR and wild-type miR-155 binding site (LPIN1 Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterthymidine kinase (HSV-TK promoter)Available SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIS1 PELO
Plasmid#60804PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains PELO 3' UTR and wild-type miR-155 sitesDepositorInsertPELO 3'UTR and wild-type miR-155 binding site (PELO Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMiR-RECK-3'UTR-miR-7-mut
Plasmid#53692PurposeLuciferase reporter assay for RECK 3'UTR that has point mutations on miR-7 binding siteDepositorInsertRECK-3'UTR (RECK Human)
UseLuciferaseTagsExpressionMutationnucleotide position 171-174 are mutated to GAAGPromoterAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pIS1 EPAS1
Plasmid#60792PurposeLuciferase reporter to measure miR-155 mediated differential repression. Contains EPAS1 3' UTR and wild-type miR-155 sitesDepositorInsertEPAS1 3'UTR and wild-type miR-155 binding site (EPAS1 Human)
UseLuciferaseTagsExpressionMammalianMutationPromoterthymidine kinase (HSV-TK promoter)Available SinceOct. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
UseTagsExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only