We narrowed to 6,930 results for: Cad
-
Plasmid#221192PurposeExpression vector for 10x-MBP-GlcR (MGlcR). GlcR is a glycolate-responsive transcriptional repressor and the gene product of pden4400 from Paracoccus denitrificans, codon optimized for E. coli.DepositorInsertglcR (pden4400 from Paracoccus denitrificans)
UseTags10x His tag with E. coli maltose binding protein …ExpressionBacterialMutationPromoterT7 promoter and T7 promoter-lacOAvailable sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTE5419_p3WJdB-glcO36
Plasmid#221193PurposeGlcR module template with glcO36 operator: T7 promoDNA template of GlcR sensor with glcO36 operator: T7 promoter-glcO36-3WJdB reporter-T7 terminator linear DNA tter-glcO36-3WJdB reporter-T7 terminatorDepositorInsertT7 promoter-glcO36
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterT7 promoter with downstream glcO36 operatorAvailable sinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41SIII-ATF6(1-373)
Plasmid#171074PurposeExpresses of ATF6α(1-373) in bacteriaDepositorInsertATF6α (ATF6 Human)
UseTagsGST and HisExpressionBacterialMutationPromoterT7 promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTY186 EGFP-T2A-ALFA-ORF6 SARS-CoV-2
Plasmid#204976PurposeCo-express EGFP and SARS-CoV-2 ORF6 N-terminally labeled with ALFA tagDepositorInsertOpen Reading Frame 6 (ORF6 SARS-CoV-2)
UseTagsALFAExpressionMammalianMutationPromoterCMVAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
UCK2_Deletion_gRNA_1
Plasmid#204672PurposeDual gRNA plasmid for UCK2 deletionDepositorInserturidine-cytidine kinase 2 (UCK2 Human)
UseLentiviralTagsExpressionMutationPromoterU6Available sinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
UCK2_Deletion_gRNA_2
Plasmid#204673PurposeDual gRNA plasmid for UCK2 deletionDepositorInserturidine-cytidine kinase 2 (UCK2 Human)
UseLentiviralTagsExpressionMutationPromoterU6Available sinceMarch 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VinculinTS-S1033A
Plasmid#211835PurposeVinculin tension sensor (VinTS) with vinculin S1033 unphosphorylatable point mutation (S1033A), in lentiviral expression vector.DepositorInsertVinculinTS-S1033A (VCL Synthetic, Chicken)
UseLentiviralTagsExpressionMutationmutated vinculin serine 1033 to alanine (S1033A),…PromoterCMVAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRRL-VinculinTS-S1033D
Plasmid#211893PurposeVinculin tension sensor (VinTS) with vinculin S1033 phosphomimetic point mutation (S1033D), in lentiviral expression vector.DepositorInsertVinculinTS-S1033D (VCL Synthetic, Chicken)
UseLentiviralTagsExpressionMutationmutated vinculin serine 1033 to aspartic acid (S1…PromoterCMVAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only