We narrowed to 9,983 results for: Uty
-
Plasmid#244169PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): hIgGVHSS-3xFLAG-IL10RbECD-IL10RbTMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human IgG-VH SS, human IL-10Rb ECD and TMD, and NTEVp 75S mutant (IL10RB Human, Synthetic)
UseSynthetic BiologyTagshuman IgG VH signal peptide - 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4312 IL-10Rb NTEVp chain (human CD8a SS) in PolyTX-mNeonGreen
Plasmid#244170PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): hCD8aSS-3xFLAG-IL10RbECD-IL10RbTMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human CD8a SS, human IL-10Rb ECD and TMD, and NTEVp (75S) (IL10RB Human, Synthetic)
UseSynthetic BiologyTagshuman CD8a signal peptide 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
L4791 VEGFR2 NTEVp chain (75S NTEVp mutant) in PolyTX-mNeonGreen
Plasmid#244172PurposeConstitutive expression of a MESA NTEVp chain encoding (N to C): VEGFR2SS-3xFLAG-VEGFR2ECD-VEGFR2TMD-NTEVp(75S)DepositorInsertMESA NTEVp chain with human VEGFR2 SS, ECD and TMD, and NTEVp (75S) (KDR Human, Synthetic)
UseSynthetic BiologyTagsVEGFR2 signal peptide - 3xFLAGExpressionMammalianMutationNTEVp_75SPromoterhEF1aAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2(miRE.FF4)-TS.FF6x1-bGH
Plasmid#235301PurposeComMAND open-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2-bGH
Plasmid#235300PurposeComMAND base gene regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-FXN-P2A-mRuby2(miRE.FF4)-TS.FF4x1-bGH
Plasmid#235302PurposeComMAND closed-loop circuit regulating FXN-P2A-mRuby2 (therapeutically relevant gene)DepositorInsertFXN-P2A-mRuby2 (FXN Human)
UseSynthetic BiologyExpressionMammalianPromoterEF1a (human EF1a)Available SinceMay 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-V561D-V5/HIS
Plasmid#234762PurposeExpression of the V561D mutant variant of human PDGFRA, which is associated with Gastrointestinal Stromal Tumor and GIST-Plus Syndrome, , constantly activatedDepositorInsertPDGFRA-V561D receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationV561D substitutionPromoterCMVAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-P577S-V5/HIS
Plasmid#234760PurposeExpression of the P577S mutant variant of human PDGFRA, which might be associated with MelanomaDepositorInsertPDGFRA-P577S receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationP577S substitutionPromoterCMVAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-R487L-V5/HIS
Plasmid#234761PurposeExpression of the R487L mutant variant of human PDGFRA, which might be associated with Gastrointestinal Stromal TumorDepositorInsertPDGFRA-R487L receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationR487L substitutionPromoterCMVAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-D842V-V5/HIS
Plasmid#234763PurposeExpression of the D842V mutant variant of human PDGFRA, which is associated with Gastrointestinal Stromal Tumor, constantly activatedDepositorInsertPDGFRA-D842V receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationD842V substitutionPromoterCMVAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-G853D-V5/HIS
Plasmid#234757PurposeExpression of the G853D mutant variant of human PDGFRA, which might be associated with MelanomaDepositorInsertPDGFRA-G853D receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationG853D substitutionPromoterCMVAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-T674I-V5/HIS
Plasmid#234756PurposeExpression of the T674I mutant variant of human PDGFRA, which is associated with Idiopathic Hypereosinophilic Syndrome, resistant to imatinibDepositorInsertPDGFRA-T674I receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationT674I substitutionPromoterCMVAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX313_PELO_WT
Plasmid#228938PurposeConstitutive expression of wild-type human PELODepositorAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-PDGFRA-K627M-V5/HIS
Plasmid#234755PurposeExpression of the K627M kinase defective mutant variant of human PDGFRADepositorInsertPDGFRA-K627M receptor tyrosine kinase, full length (PDGFRA Human)
TagsV5/HisExpressionMammalianMutationK627M substitutionPromoterCMVAvailable SinceMarch 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 shCavin1KDR-EGFP
Plasmid#187254PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of mouse Cavin1 (Cavin1 rescue)DepositorAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0_shRNAHsCavin1_Del4UC1_EGFP
Plasmid#229691PurposeLentiviral expression of shRNA targeting Cavin1 + reconstitution of zebrafish mutant Cavin1 (Del4UC1)DepositorUseLentiviralTagsEGFPMutationDel4UC1PromoterLTR viral promoterAvailable SinceJan. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR-GAL4-UAS—sTNFaR-IRES-mCherry-PGK-BFP
Plasmid#223214PurposeLentiviral vector - mCherry reporter and sTNFaR for Gal4DBDVP64 synNotch receptors with a constitutive BFPDepositorAvailable SinceDec. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaAnillin homology domain
Plasmid#187277PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Anillin homology domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaAnillin homology domainPromoterU6, CMVAvailable SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
AGTR1-DuET
Plasmid#213183PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only