We narrowed to 28,942 results for: tat
-
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJExpress401-KDAC8 D101N
Plasmid#224348PurposeExpresses human KDAC8 (HDAC8) D101N in E. coliDepositorInsertKDAC8 (HDAC8 Human)
TagsTEV-cleavable His6ExpressionBacterialMutationAspartate 101 mutated to asparaginePromoterT5Available SinceFeb. 19, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGL3_5UTR_Myc_FLuc Compensatory Mutant
Plasmid#229504PurposeMyc 5' untranslated region firefly luciferase reporter with compensatory mutations in the region bound by RBM42DepositorInsertMyc 5'UTR_CompMutant
ExpressionMammalianMutationMutations in bp 363-394PromoterSV40Available SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB758
Plasmid#210033PurposeContains inducible Cas7-P2A-Cas5-T2A-Cas8, rtTA-T2A-puroDepositorInsertsCas7-P2A-Cas5-T2A-Cas8
rtta-T2A-puro
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterEF-1α and TRE3GAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ 3xFLAG-FEM1B C186S
Plasmid#230995PurposeTransient overexpression of mouse FEM1B in mammalian cells. Mutation abolishes substrate binding.DepositorAvailable SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ 3xFLAG-FEM1B L597A
Plasmid#230994PurposeTransient overexpression of catalytic null mouse FEM1B in mammalian cells. Mutation abolishes interaction with CUL2.DepositorAvailable SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-3xFlag-dCas13-MBD6MBD
Plasmid#228233PurposeFor targeted tethering of the MBD domain of human MBD6 using dCas13DepositorAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFB-Dual-MBP-NavAb (KAV/G94C/Q150C)
Plasmid#226884PurposeExpresses a mutant of the Arcobacter butzleri voltage-gated sodium channel fused to an MBP tag in insect cellsDepositorInsertNaVAb
TagsMBPExpressionInsectMutationR4A, N49K, L109A, M116VPromoterPolyhedrinAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJExpress401-KDAC8 D101R
Plasmid#224349PurposeExpresses human KDAC8 (HDAC8) D101R in E. coliDepositorInsertKDAC8 (HDAC8 Human)
TagsTEV-cleavable His6ExpressionBacterialMutationAspartate 101 mutated to argininePromoterT5Available SinceOct. 28, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJExpress401-KDAC8 D101A
Plasmid#224347PurposeExpresses human KDAC8 (HDAC8) D101A in E. coliDepositorInsertKDAC8 (HDAC8 Human)
TagsTEV-cleavable His6ExpressionBacterialMutationAspartate 101 mutated to alaninePromoterT5Available SinceOct. 22, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pU6-hL1-5'_3.3kb plasmid
Plasmid#226006PurposePlasmid used to generate DNA-FISH probe targeting at human L1HSDepositorInsertHuman L1 element 3.3kb sequences at the 5' end
UseSynthetic BiologyAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Ctr1-gRNA-EGFP
Plasmid#226000PurposeNegative control for CRISPRi-KDDepositorInsertnegtive control sgRNA of no specific targets in human genome
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Ctr2-gRNA-EGFP
Plasmid#226001PurposeNegative control for CRISPRi-KDDepositorInsertnegtive control sgRNA of no specific targets in human genome
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-NCL-gRNA1-EGFP
Plasmid#226004PurposeCRISPRi-KD of human NucleolinDepositorInsertsgRNA targeting human Nucleolin (NCL Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-NCL-gRNA2-EGFP
Plasmid#226005PurposeCRISPRi-KD of human NucleolinDepositorInsertsgRNA targeting human Nucleolin (NCL Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-miR-455-WT
Plasmid#215881PurposeThis plasmid encodes luciferase which has microRNA binding sites in 3'UTR for detecting the microRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of miR-455-WT (MIR455 Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-miR-376a1(3p)-I-type
Plasmid#215883PurposeThis plasmid encodes luciferase which has microRNA binding sites in 3'UTR for detecting the microRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of miR-376a1(3p)-I-type (MIR376A1 Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-miR-589(5p)-I-type
Plasmid#215884PurposeThis plasmid encodes luciferase which has microRNA binding sites in 3'UTR for detecting the microRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of miR-589(5p)-I-type (MIR589 Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-1-miR-589(3p)-I-type
Plasmid#215885PurposeThis plasmid encodes luciferase which has microRNA binding sites in 3'UTR for detecting the microRNA silencing activity.DepositorInsertthree tandem repeats of seed-matched (SM) sequence of miR-589(3p)-I-type (MIR589 Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only