We narrowed to 24,488 results for: promoter
-
Plasmid#166442PurposeBacterial expression of 6x His tagged mCherry-TEAD4 -IDR fusion proteinDepositorInsertmCherry, TEAD4-IDR (TEAD4 Human)
ExpressionBacterialAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
193_pAAV-ProA35-CatCh-GFP-WPRE
Plasmid#125918PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA35Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
105_pAAV-ProC16-CatCh-GFP-WPRE
Plasmid#125951PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC16Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
194_pAAV-ProB15-CatCh-GFP-WPRE
Plasmid#125935PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB15Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
216_pAAV-ProD24-CatCh-GFP-WPRE
Plasmid#126000PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD24Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
27_pAAV-ProB12-CatCh-GFP-WPRE
Plasmid#125932PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB12Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ACE2 receptor 19-615
Plasmid#167012PurposeGateway-compatible Entry vector encoding ACE2 receptor (aa19-615) interacting with spike (S1) RBD domain from SARS-CoV-2DepositorAvailable SinceMarch 29, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
131_pAAV-ProB13-CatCh-GFP-WPRE
Plasmid#125933PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB13Available SinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
55_pAAV-ProA13-CatCh-GFP-WPRE
Plasmid#125896PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA13Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
46_pAAV-ProC11-CatCh-GFP-WPRE
Plasmid#125946PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC11Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
11_pAAV-ProC6-CatCh-GFP-WPRE
Plasmid#125942PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC6Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
40_pAAV-ProC9-CatCh-GFP-WPRE
Plasmid#125944PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProC9Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
95_pAAV-ProA28-CatCh-GFP-WPRE
Plasmid#125911PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA28Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
61_pAAV-ProA18-CatCh-GFP-WPRE
Plasmid#125901PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA18Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
5_pAAV-ProA9-CatCh-GFP-WPRE
Plasmid#125893PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProA9Available SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
214_pAAV-ProD22-CatCh-GFP-WPRE
Plasmid#125998PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD22Available SinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
159_pAAV-ProD3-CatCh-GFP-WPRE
Plasmid#125979PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProD3Available SinceSept. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-RNA-pCAG-bpNLS-miCBE-SV40NLS-bGH polyA-pCMV-mCherry-AmpR
Plasmid#248061PurposeExpression vector for expression of miCBE-ωRNA v2 driven by chicken β-actin promoter and mCherry driven by CMV promoter.DepositorInsertpU6-RNA-pCAG-bpNLS-miCBE-SV40NLS-bGH polyA-pCMV-mCherry-AmpR
UseCRISPRTagsflagExpressionMammalianMutationnonePromoterCAG, U6Available SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-Nppa-Cre
Plasmid#247326PurposeExpresses Cre recombinase under the control of the Nppa Promoter.DepositorInsertNppa-Cre
UseAAVExpressionMammalianMutationTagRFP is out of frame and therefore not translat…PromoterNppa Proximal promoterAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only