We narrowed to 29,073 results for: Tat
-
Plasmid#244805PurposeExpress mEGFP-tagged fusion protein NUP98_NSD1 with an IDR deletionDepositorInsertNUP98_NSD1Δ1-470
Tagsmonomeric EGFPExpressionMammalianMutationDeletion of an IDR (amino acids 1-470 deleted)Available SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_PAX5_ZCCHC7Δ1-447
Plasmid#244806PurposeExpress mEGFP-tagged fusion protein PAX5_ZCCHC7 with an IDR deletionDepositorInsertPAX5_ZCCHC7Δ1-447
Tagsmonomeric EGFPExpressionMammalianMutationDeletion of an IDR (amino acids 1-447 deleted)Available SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_ARID1B_ZNF384Δ1-260
Plasmid#244801PurposeExpress mEGFP-tagged fusion protein ARID1B_ZNF384 with an IDR deletionDepositorInsertARID1B_ZNF384Δ1-260
Tagsmonomeric EGFPExpressionMammalianMutationDeletion of an IDR (amino acids 1-260 deleted)Available SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_BRD9_NUTM1Δ1-152
Plasmid#244802PurposeExpress mEGFP-tagged fusion protein BRD9_NUTM1 with an IDR deletionDepositorInsertBRD9_NUTM1Δ1-152
Tagsmonomeric EGFPExpressionMammalianMutationDeletion of an IDR (amino acids 1-152 deleted)Available SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNK036C_AttB_mkozak_mGreenLantern-STIM1_IRES_mCherry-H2A-P2A-PuroR
Plasmid#232938PurposeLow expression plasmid of STIM1 with N-terminal mGreenLantern tag for Matreyek Bxb1 (GT) landing padDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
J364B_AttB_mkozak_STIM1_IRES_CaMPARI2-P2A-PuroR
Plasmid#232939PurposeLow expression plasmid of STIM1 with fluorescent calcium biosensor CaMPARI2 for Matreyek Bxb1(GT) landing padDepositorInsertsExpressionMammalianAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSmBit-CHIP-G132N
Plasmid#236065PurposeSmBit-CHIP expression with G132N substitutionDepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSmBit-CHIP-K30A
Plasmid#236066PurposeSmBit-CHIP expression with K30A substitutionDepositorAvailable SinceSept. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CaMKII-RFP-p2A-DAAO(R285A)-NES
Plasmid#238919PurposeMammalian expression of mutated DAAO(R285A) with a nuclear export signal and RFP as a reporter in excitatory neuronsDepositorInsertRFP-p2A-DAAO(R285A)-NES
UseAAVExpressionMammalianPromoterCaMKIIalfaAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
VAMP4 KD1 mScarlet
Plasmid#174407Purposelentiviral vector for VAMP4 knock-down in rat cells, KD1 shRNADepositorInsertvesicle associated membrane protein 4 (Vamp4 Rat)
UseLentiviralTagsmScarletExpressionMammalianPromoterH1-UbiquitinAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT-Myc-BirA*G3
Plasmid#240233PurposeExpression of Myc-BirA*-G3 under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertMyc-BirA*G3
ExpressionInsectPromoterMTAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGIG-Sema7A-KCE
Plasmid#190651PurposeExpresses Mouse Sema7A with RGD motif mutated to KCEDepositorAvailable SinceJuly 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-SOS1(dog)-gRNA1
Plasmid#228755PurposeA knockout vector for dog SOS1.DepositorInsertA gRNA targeting the dog SOS1 gene and the cDNA of CRISPR-Cas9 (SOS1 canis lupus)
ExpressionMammalianAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAD131_hIrg1_M154I_pCMV6
Plasmid#239120PurposehACOD1 with M154I mutation in mammalian expression vectorDepositorInsertcis-aconitate decarboxylase (ACOD1 Human)
TagsMyc and FLAGExpressionMammalianMutationM154IPromoterCMVAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT-Myc-BirA*G3-ER
Plasmid#240234PurposeExpression of ER-localized Myc-BirA*-G3 under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertBiP-Myc-BirA*G3-KDEL
ExpressionInsectPromoterMTAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR_CG6867_nostop
Plasmid#240238PurposeGateway entry clone with CG6867 without stop codonDepositorInsertCG6867 (CG6867 Fly)
UseGateway shuttle vectorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-SOX17WT
Plasmid#216176PurposeGenerate lentiviruses encoding for wild-type SOX17DepositorInsertSOX17 (SOX17 Human)
UseLentiviralMutationGlu113Glu (silent mutation); Glu120Glu (silent mu…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRRL-SFFV_V5-CHIC2-C6S_Tomato
Plasmid#238128PurposeExpresses V5-tagged CHIC2 (with C6S mutation) with Tomato selectable marker.DepositorInsertV5-tagged CHIC2 with C6S mutation
TagsV5ExpressionMammalianMutationChanged cysteines from amino acids 102-109 to ser…PromoterSFFVAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmBorealin-OLLAS
Plasmid#237439PurposeExpresses mouse Borealin tagged with OLLAS at C-term; made for in vitro transcription (T7 promoter)DepositorAvailable SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only