We narrowed to 15,275 results for: grn
-
-
lentiCRISPR v2-sgNCKAP1-2
Plasmid#210134Purposeknock out NCKAP1 in mammalian cellsDepositorInsertNck-associated protein 1 (NCKAP1 Human)
UseCRISPRAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1 sgTollip
Plasmid#196546PurposeLentiviral CRISPR-Cas9 plasmid containing gRNA targeting exon 1 of human Tollip. Used for generation of Tollip protein knockouts in human cell lines.DepositorAvailable sinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Easy-AtpU6-26
Plasmid#160218PurposeAtpU6-26 Golden Gate level 0 piece to express gRNAsDepositorInsertpAtU6-26 promoter
UseGolden gate level 0 piece to express grnasAvailable sinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1B
Plasmid#185383PurposeFor mammalian expression of shRNA: GAGCAGAAGAGGATGAATTTA that targets human PPM1BDepositorAvailable sinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgNeo2
Plasmid#177231PurposeExpresses neomycin gRNA's ( bU6 and hU6 ), non-targeting gRNA ( mU6 ) and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgNeo2
UseLentiviralPromoterbU6/mU6/hU6Available sinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTX1-SMN1-exon7-ESE1
Plasmid#126041PurposeIn-vitro-transcription of SMN1-exon7-ESE1 RNA in NMR tube for "Systems NMR" analysisDepositorInsertSMN1 exon7 ESE1
Available sinceMay 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone3
Plasmid#162130PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPU-huTRIMmiR30-L1221
Plasmid#132937PurposeAll-in-one huTRIM5 rescue-control shRNA knockdownDepositorInserthuman TRIM5
UseLentiviral and RNAiExpressionMammalianPromoterSFFVAvailable sinceOct. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCRISP_IS
Plasmid#120425PurposeThis plasmid encodes the complete CRISPR/dCas9 machinery for repressing transposition of the following bacterial Insertion Sequences: IS1, IS3 and IS5.DepositorInsertCRISPR spacers targeting IS1, IS5, IS3
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterconstitutiveAvailable sinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shNFS1_2
Plasmid#102964PurposeSuppression of NFS1DepositorInsertshNFS1_2 (NFS1 Human)
UseLentiviral and RNAiAvailable sinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMLS719
Plasmid#188894PurposeminiMos Arm sgRNA expression vectorDepositorInsertPU6(K09B11.12)::miniMos Arm sgRNA
ExpressionWormAvailable sinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
HCP5
Plasmid#166107PurposeThis plasmid encodes a Cas9 protein as well as a sgRNAs that targets the C-terminus of Cyr1.DepositorAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgALCAM
Plasmid#83929PurposeLentiviral vector expressing an sgRNA targeting ALCAM. NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgALCAM
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEE388
Plasmid#149286PurposeT-DNA encoding TRV2 with mFT augmented gRNA targeting NbAGDepositorInsertp35S:TRV2_NbAGsgRNA1_mFT:tNos
ExpressionPlantPromoter35SAvailable sinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEE385
Plasmid#149289PurposeT-DNA encoding TRV2 with Truncated FT augmented gRNA targeting NbAGDepositorInsertp35S:TRV2_NbAGsgRNA2_TrunFT:tNos
ExpressionPlantPromoter35SAvailable sinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHnS 2comp Donor;smFP-V5 KO;Template ORF0
Plasmid#240304PurposeDonor:smFP-V5 KO:TemplateDepositorInsertTemplate gRNA
UseAAVMutationNAAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJMP8823
Plasmid#220901PurposeMobileCRiSPRi test system encoded on a kanR Tn7 transposon; mScarlet-I, PD-sgRNA (mscar targeting), and PC-dCas9-novoDepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable sinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJMP8923
Plasmid#220904PurposeMobileCRiSPRi test system encoded on a kanR Tn7 transposon; mScarlet-I, PD-sgRNA (BsaI site), and PG-dCas9-novoDepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable sinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP8930
Plasmid#220905PurposeMobileCRiSPRi system encoded on a kanR Tn7 transposon; PD-sgRNA (BsaI site) and PC-dCas9-novo (for cloning new guides)DepositorInsertdCas9-novo
UseCRISPRTags3xMycExpressionBacterialMutationD10A, H840AAvailable sinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by