We narrowed to 2,187 results for: AP1
-
Plasmid#81519PurposeGateway Donor vector containing KEAP1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pDONR223_KEAP1_p.S45F
Plasmid#81496PurposeGateway Donor vector containing KEAP1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_KEAP1_p.G419W
Plasmid#81505PurposeGateway Donor vector containing KEAP1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_KEAP1_p.S102L
Plasmid#82778PurposeGateway Donor vector containing KEAP1, part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_KEAP1_p.G603W
Plasmid#81492PurposeGateway Donor vector containing KEAP1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
AKAP13
Plasmid#73230PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertAKAP13 (AKAP13 Human)
TagsHis-6-TEVExpressionBacterialMutationpfam00621:RhoGEF 2002-2193, pfam00169:PH 2236-2336PromoterT7Available SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_RABGAP1L_BCAS3
Plasmid#205906PurposeExpress mEGFP-tagged fusion protein, RABGAP1L_BCAS3 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
CL20_mEGFP_NPTN_CLUAP1
Plasmid#205869PurposeExpress mEGFP-tagged fusion protein, NPTN_CLUAP1 from patient-derived sequenceDepositorAvailable SinceNov. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.11_Nued2_E1_dAP1-2
Plasmid#203837PurposeLuciferase reporter plasmid for Igf1 enhancer 1 with both AP-1 sites knocked outDepositorInsertdAP1-2
ExpressionMammalianMutationKO of both AP1 sitesAvailable SinceOct. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.11_Nued2_E1_dAP1
Plasmid#203835PurposeLuciferase reporter plasmid for Igf1 enhancer 1 containing only the downstream AP1 siteDepositorInsertdAP1
ExpressionMammalianMutationKO of AP1 upstreamAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTriEx4_Rap1
Plasmid#184662PurposeMammalian expression of mouse Rap1DepositorInsertrap1
ExpressionMammalianPromoterCMVAvailable SinceJune 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
MNEAP1ec
Plasmid#131020PurposeExpression of plant LINC fluorescent fusion protein for cell biologyDepositorInsertMNEAP1
UseGateway entry vectorTagseGFP-FLAG-HAAvailable SinceMay 6, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
MNEAP1exp
Plasmid#131021PurposeExpression of plant LINC fluorescent fusion protein for cell biologyDepositorInsertMNEAP1
TagseGFP-FLAG-HAExpressionPlantPromoterP35SAvailable SinceMay 6, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUAP12008
Plasmid#177036PurposeLevel 0 promoter and 5'UTR part for MoClo assembly, GGAG-CCATDepositorInsertCauliflower Mosaic Virus (CaMV) 35S promoter and Tobacco Mosaic Virus (TMV) omega 5' UTR
UseSynthetic BiologyAvailable SinceNov. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_BZRAP1-2/3
Plasmid#91551PurposeProtein expression and purification of human SH3 domain construct BZRAP1-2/3DepositorInsertBZRAP1-2/3 (TSPOAP1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_BZRAP1-3/3
Plasmid#91559PurposeProtein expression and purification of human SH3 domain construct BZRAP1-3/3DepositorInsertBZRAP1-3/3 (TSPOAP1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHH0103_BZRAP1-1/3
Plasmid#91487PurposeProtein expression and purification of human SH3 domain construct BZRAP1-1/3DepositorInsertBZRAP1-1/3 (TSPOAP1 Human)
ExpressionBacterialAvailable SinceMarch 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAP1893-1
Plasmid#105248Purposehuman GFP11 with tagRFP 33bp downstream in Lamin A/C (recoded)DepositorInsertInsertion of GFP11 at cut tagRFP 33bp downstream (recoded *) in Lamin A/C (LMNA Human)
ExpressionBacterialAvailable SinceFeb. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
DAZAP1
Plasmid#99765PurposeExpresses S. meditearranea DAZAP1DepositorInsertCDC25-3
ExpressionBacterialAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only