We narrowed to 27,048 results for: STI
-
Plasmid#103216PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-130a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-130a-3p target (MIR130A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-28-3p
Plasmid#103385PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-28-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-630
Plasmid#103690PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-630 target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-633
Plasmid#103691PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-633 target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-135b-5p
Plasmid#103229PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-135b-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-135b-5p target (MIR135B Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-584-5p
Plasmid#103665PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-584-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-584-5p target (MIR584 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7g-5p
Plasmid#103158PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7g-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7g-5p target (MIRLET7G Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-125a-5p
Plasmid#103188PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-125a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-125a-5p target (MIR125A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-876-3p
Plasmid#103742PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-876-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-876-3p target (MIR876 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-301a-3p
Plasmid#103396PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-301a-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-301a-3p target (MIR301A Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-30c-1-3p
Plasmid#103413PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-30c-1-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-miR-30c-1-3p target (MIR30C1 Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-miR-25-5p
Plasmid#103376PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-miR-25-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7e-5p
Plasmid#103153PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7e-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7e-5p target (MIRLET7E Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7e-3p
Plasmid#103152PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7e-3p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7e-3p target (MIRLET7E Human)
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pVEA3-KNC
Plasmid#234801PurposeMammalian expression of bovine arrestin-3 (K11A, K12A, L49A, D51A, R52A, L69A, Y239A, D241A, C252A, P253A, D260A, Q262A)DepositorInsertArrestin-3 (ARR3 Bovine)
TagsVenusExpressionMammalianMutationK11A, K12A, L49A, D51A, R52A, L69A, Y239A, D241A,…Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-TMEM173-ts1
Plasmid#174283PurposeTMEM173 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-TMEM173-ts2
Plasmid#174284PurposeTMEM173 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-TMEM173-ts3
Plasmid#174285PurposeTMEM173 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
p Pcrg1: Khd4-Ada-Gfp (CbxR)
Plasmid#203734PurposePlasmid for ectopic integration and expression of Khd4-Ada-Gfp. The 4282 bp khd4-ORF is fused C-terminally to the 1200 bp adar catalytic domain (Ada) with three repeats of GGGGS linker in between, folDepositorInsertKhd4-Ada-Gfp
TagsGfpExpressionBacterialPromoterPcrg1Available SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-HTR2A-NTEV-TCS-GV-2xHA
Plasmid#194367PurposeSplit TEV assaysDepositorInsertSP-HTR2A-NTEV-TCS-GV-2xHA (HTR2A Synthetic, Human)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_HTR2A-V2R-NTEV-TCS-GV-2xHA
Plasmid#194368PurposeSplit TEV assaysDepositorInsertHTR2A-V2R-NTEV-TCS-GV-2xHA (HTR2A Synthetic, Human)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-HTR2A-V2R-NTEV-TCS-GV-2xHA
Plasmid#194369PurposeSplit TEV assaysDepositorInsertSP-HTR2A-V2R-NTEV-TCS-GV-2xHA (HTR2A Synthetic, Human)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_AVPR2-V2R-NTEV-TCS-GV-2xHA
Plasmid#194372PurposeSplit TEV assaysDepositorInsertAVPR2-V2R-NTEV-TCS-GV-2xHA (AVPR2 Synthetic, Human)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-AVPR2-V2R-NTEV-TCS-GV-2xHA
Plasmid#194373PurposeSplit TEV assaysDepositorInsertSP-AVPR2-V2R-NTEV-TCS-GV-2xHA (AVPR2 Synthetic, Human)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-GCGR-NTEV-TCS-GV-2xHA
Plasmid#194375PurposeSplit TEV assaysDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_GCGR-V2R-NTEV-TCS-GV-2xHA
Plasmid#194376PurposeSplit TEV assaysDepositorInsertGCGR-V2R-NTEV-TCS-GV-2xHA (GCGR Synthetic, Human)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-DRD1-V2R-NTEV-TCS-GV-2xHA
Plasmid#194361PurposeSplit TEV assaysDepositorInsertSP-DRD1-V2R-NTEV-TCS-GV-2xHA (DRD1 Synthetic, Human)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_SP-DRD2-NTEV-TCS-GV-2xHA
Plasmid#194363PurposeSplit TEV assaysDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_DRD2-V2R-NTEV-TCS-GV-2xHA
Plasmid#194364PurposeSplit TEV assaysDepositorInsertDRD2-V2R-NTEV-TCS-GV-2xHA (DRD2 Synthetic, Human)
Tags2xHAExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only