We narrowed to 14,068 results for: crispr grnas
-
Plasmid#164804PurposeREDIT backbone for nickase Cas9n, pU6-MS2-gRNA-backbone(BbsI)-CBH-SpCas9n(D10A)-T2A-EGFPDepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pYPQ144-ZmUbi-tRNA
Plasmid#158402PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ134-tRNA2.0; assembly of 4 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
CRISPseq-mCherry-backbone
Plasmid#85708PurposeBackbone for CRISPR/Cas9 screening with single cell RNA-seq. Lentiviral plasmid for cloning of gRNAs and Unique Guide Index (UGI), with an mCherry fluorescent marker. Does NOT include Cas9.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ145-ZmUbi-tRNA
Plasmid#158403PurposeGateway entry clone and Golden Gate recipient for pYPQ131-tRNA2.0 to pYPQ135-tRNA2.0; assembly of 5 gRNAsDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVG1
Plasmid#111444PurposeUnified Solo vector pV1382 + sgScADE2 + ScADE2 stop codon repair tempateDepositorInsertCaCas9/sgScADE2/stop-codon repair
UseCRISPRExpressionYeastAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMBEC8
Plasmid#187599PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Apramycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
ExpressionBacterialPromotertrcAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133C2.0
Plasmid#99893PurposeGolden Gate entry vector to express the 3rd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU6Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131C2.0
Plasmid#99886PurposeGolden Gate entry vector to express the 1st gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU6Available SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132C2.0
Plasmid#99889PurposeGolden Gate entry vector to express the 2nd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU6Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUbi-RZ-Aac.4
Plasmid#158406PurposeExpress single gRNA with Aac.4 scaffold (with four MS2 binding sites) under ZmUbi promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132D2.0
Plasmid#99890PurposeGolden Gate entry vector to express the 2nd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUbi-RZ-Aa3.8.5
Plasmid#158407PurposeExpress single gRNA with Aa3.8.5 scaffold (with four MS2 binding sites) under ZmUbi promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterMaize ubiquitin 1Available SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pV1386
Plasmid#111445PurposeSolo vector pV1382 + sgScADE2DepositorInsertCaCas9/sgScADE2/stop-codon repair
UseCRISPRExpressionYeastAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133D2.0
Plasmid#99894PurposeGolden Gate entry vector to express the 3rd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131D2.0
Plasmid#100044PurposeGolden Gate entry vector to express the 1st gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under OsU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterOsU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgHtr2c (mouse/rat)
Plasmid#249541PurposeCre-dependent editing of Htr2c with SaCas9DepositorAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-2O-crBFP_EF1a-BFP
Plasmid#224783PurposeBFP-targeting crRNA for RfxCas13d expressed from hU6-2xTetO promoter and target BFP protein expressed from EF1a promoterDepositorInsertcrBFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-2O-crEGFP_EF1a-BFP
Plasmid#224784PurposeEGFP targeting crRNA for RfxCas13d expressed from hU6-2xTetO promoter and non-target BFP protein expressed from EF1a promoterDepositorInsertcrEGFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-CrEGFP_EF1a-BFP
Plasmid#224786PurposeEGFP targeting crRNA for RfxCas13d expressed from hU6 promoter and non-target BFP protein expressed from EF1a promoterDepositorInsertcrBFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6 and hU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only