-
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAT_g1 gRNA
Plasmid#86005Purposeplasmid vector encoding for U6-driven AAT_g1 gRNADepositorInsertpU6-AAT_g1 sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterpU6Available sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAT_g2 gRNA
Plasmid#86006Purposeplasmid vector encoding for U6-driven AAT_g2 gRNA (Z-allele specific)DepositorInsertpU6-AAT_g2 sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHU6_Ch5_155183064-gRNA-for
Plasmid#81214PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 3' region of pCALNL_Ch5 reporterDepositorInserthU6 expression of gRNA
UseTagsExpressionMammalianMutationPromoterU6Available sinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-for2
Plasmid#81209Purposefor targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 3' of gix site)DepositorInserthU6 expression of gRNA
UseTagsExpressionMammalianMutationPromoterU6Available sinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK gRNA (BRDN0001146383)
Plasmid#76329Purpose3rd generation lentiviral gRNA plasmid targeting human GKDepositorInsertGK (GK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK gRNA (BRDN0001148115)
Plasmid#76326Purpose3rd generation lentiviral gRNA plasmid targeting human GKDepositorInsertGK (GK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK gRNA (BRDN0001145307)
Plasmid#76327Purpose3rd generation lentiviral gRNA plasmid targeting human GKDepositorInsertGK (GK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK gRNA (BRDN0001146936)
Plasmid#76328Purpose3rd generation lentiviral gRNA plasmid targeting human GKDepositorInsertGK (GK Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-gRNA:Asip
Plasmid#60968PurposeExpression vector of rat Asip guide RNADepositorInsertAgouti signaling protein gRNA (Asip Rat)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-gRNA:kit-1
Plasmid#60969PurposeExpression vector of rat Kit-1 guide RNADepositorInsertv-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Kit Rat)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-gRNA:kit-2-1
Plasmid#60970PurposeExpression vector of rat Kit-2-1 guide RNADepositorInsertv-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Kit Rat)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-gRNA:kit-2-2
Plasmid#60971PurposeExpression vector of rat Kit-2-2 guide RNADepositorInsertv-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Kit Rat)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6_empty-sgRNA(PP7)
Plasmid#232432Purposeempty gRNA backbone which contains the PP7 aptamer in the scaffold tetraloopDepositorInsertPP7-tagged sgRNA scaffold driven by human U6 promoter
UseCRISPRTagsExpressionMutationPromoterU6Available sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDY1513 AAVS1 sgRNA
Plasmid#234832PurposesgRNA for AAVS1 STITCHR insertionDepositorInsertAAVS1 sgRNA
UseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
Non-specific sgRNA
Plasmid#109432PurposeMLM3636 backbone containing a gRNA that does not bind to any sequence in the human genome.DepositorInsertNon-specific gRNA
UseCRISPRTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDY1622 NOLC1 sgRNA 1
Plasmid#234833PurposesgRNA 1 for NOLC1 STITCHR insertionDepositorInsertNOLC1 sgRNA (NOLC1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-GG-acceptor
Plasmid#132777PurposePrime editing in mammalian cellsDepositorInsertExchangeable cassette
UseTagsExpressionMammalianMutationSee manuscriptPromoterU6Available sinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only