We narrowed to 25,334 results for: Spr
-
Plasmid#188486PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting cytomegaloviral promoter site 162.DepositorInsertCMV promoter sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-mGreenLantern/EGFP
Plasmid#188482PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV492
Plasmid#177700PurposePlasmid expressing optimized Cas9 and NAT marker. Compatible with CTG-clade yeast species.DepositorInsertsCas9
Nat
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRHR2p (Debaryomyces hansenii ) and TEF1p (Ashbya …Available SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV152
Plasmid#179916PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 152.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato166/892
Plasmid#179919PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 166 and 892.DepositorInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV51
Plasmid#179915PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 51.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-CMV162
Plasmid#179917PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting cytomegaloviral promoter site 162.DepositorInsertCMV promoter sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern332
Plasmid#179914PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern fluorescent protein site 332.DepositorInsertmGreenLantern sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV491
Plasmid#177699PurposePlasmid expressing optimized Cas9 and NAT marker. Compatible with CTG-clade yeast species.DepositorInsertsCas9
Nat
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ) and TEF1p (Ashbya …Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIV488
Plasmid#177696PurposePlasmid expressing optimized Cas9 and NAT marker. Compatible with CTG-clade yeast speciesDepositorInsertsCas9
Nat
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterTDH3p (Candida lusitaniae) and TEF1p (Ashbya goss…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA EBFP2_TtoC and hairpin extension
Plasmid#167921PurposeLentiviral vector for expressing U6 FE-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA KanR neo_zhang2.0
Plasmid#167917PurposeLentiviral vector for expressing U6 MS2-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Blasto_TtoC and hairpin extension
Plasmid#167920PurposeLentiviral vector for expressing U6 FE-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA EYFP_TtoC and hairpin extension
Plasmid#167922PurposeLentiviral vector for expressing U6 FE-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Hygro_TtoC and hairpin extension
Plasmid#167923PurposeLentiviral vector for expressing U6 FE-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA iRFP713_TtoC and hairpin extension
Plasmid#167924PurposeLentiviral vector for expressing U6 FE-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA KanR neo_TtoC and hairpin extension
Plasmid#167925PurposeLentiviral vector for expressing U6 FE-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB700 lenti gRNA Puro_TtoC and hairpin extension
Plasmid#167927PurposeLentiviral vector for expressing U6 FE-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Cquin_728
Plasmid#176656PurposeExpression of sgRNA under C. quinquefasciatus U6 (CPIJ039728) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only