We narrowed to 15,001 results for: GRN
-
Plasmid#72712PurposeLentiviral expression of shRNA against CRTC3 (3rd generation)DepositorInsertCRTC3
UseLentiviralTagsCMV-EGFPExpressionMammalianPromoterU6Available SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSMP-NR2F1_2
Plasmid#36363DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSMP-NR2F1_3
Plasmid#36364DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLLOXmPOLBeta
Plasmid#24174DepositorAvailable SinceMay 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 SLC31A1_sg2
Plasmid#244870PurposeKnockout of human SLC31A1DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 SLC31A1_sg1
Plasmid#244869PurposeKnockout of human SLC31A1DepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-CNCB_sgEIF3D-4
Plasmid#236766PurposeA piggybac-based vector containing mouse U6 promoter-driven EIF3D sgRNA #4 and CAG promoter-driven nuclear-localized Clover-T2A-BSR.DepositorInsertEIF3D sgRNA-4 (EIF3D Human)
UsePiggybacExpressionMammalianPromotermouse U6 promoter and mouse U6 promoter, CAG prom…Available SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9.luxR(mut)-sggfp
Plasmid#236185PurposeThe plasmid pQdCas9.luxR(mut)-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the GFP gene. Additionally, this plasmid contains a mutation in the luxR gene.DepositorInsertQuorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(C)
Plasmid#236043PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(C) expresses the dCas12a endonuclease and the sgRNA (design C) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (C) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR36(DjCas13d-SapI)-CMV-intron-MCS-pA
Plasmid#233031PurposeTo express a DjCas13d-compatible gRNADepositorInsertDjCas13d-compatible gRNA expression cassette
UseAAVAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAGK112
Plasmid#228127PurposeExpress node 1531 retron with split retron ncRNA and gRNA to edit (SNIP + PAM recode) HEK4 gene in human cellsDepositorInsertRetron node 1531 split retron ncRNA and gRNA to edit HEK4 gene (SNP + PAM recode) in human cells
ExpressionMammalianPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAGK61
Plasmid#228121PurposeExpress node 1467 retron with split retron ncRNA and gRNA to edit (10bp barcode) EMX1 gene in human cellsDepositorInsertRetron node 1467, split retron ncRNA and gRNA to edit EMX1 gene (10bp barcode) in human cells
ExpressionMammalianPromoterCAG for RT, U6/H1 for ncRNA/gRNAAvailable SinceDec. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PCNT
Plasmid#227284PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of PCNT for knock-in.DepositorAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-PEX3
Plasmid#227303PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of PEX3 for knock-in.DepositorAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-MAPRE1
Plasmid#207793PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of MAPRE1 for knock-in.DepositorInsertsgRNA Targeting C-terminus of MAPRE1 (MAPRE1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX459v3-eSpCas9(1.1)
Plasmid#178800PurposeHigh-fidelity eSpCas9(1.1) with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-TUBB4B
Plasmid#207785PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of TUBB4B for knock-in.DepositorInsertsgRNA Targeting C-terminus of TUBB4B (TUBB4B Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-MIR302-7guides-PGK-Puro
Plasmid#201960PurposeEBNA episome plasmid for U6 promoter-driven expression of 7 gRNAs targeting miRNA302/367. Includes PGK-puro selection cassetteDepositorInsertMIR302-7g-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-dCTNNA1
Plasmid#176032PurposeA knock-out vector for dog CTNNA1 (alpha-1-catenin)DepositorInsertA gRNA targeting the dog CTNNA1 (alpha-1-catenin) gene and the cDNA of Cas9 (CTNNA1 )
UseCRISPRExpressionMammalianAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only