We narrowed to 15,275 results for: grn
-
-
PX458_BCL6_iso1_2
Plasmid#104047PurposeEncodes gRNA for 3' target of human BCL6_iso1 along with Cas9 with 2A GFPDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBCL6_iso1 gRNA (BCL6 Human)
UseCRISPRExpressionMammalianAvailable sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX458_BCL6_iso1_1
Plasmid#104046PurposeEncodes gRNA for 3' target of human BCL6_iso1 along with Cas9 with 2A GFPDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBCL6_iso1 gRNA (BCL6 Human)
UseCRISPRExpressionMammalianAvailable sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX458_TEAD3_2
Plasmid#86338PurposeEncodes gRNA for 3' target of human TEAD3DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against TEAD3 (TEAD3 Human)
UseCRISPRAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZGPAT_2
Plasmid#86328PurposeEncodes gRNA for 3' target of human ZGPATDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against ZGPAT (ZGPAT Human)
UseCRISPRAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZGPAT_1
Plasmid#86327PurposeEncodes gRNA for 3' target of human ZGPATDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against ZGPAT (ZGPAT Human)
UseCRISPRAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
TU#1806_CRISPR_unc-73_exon21
Plasmid#82360Purposeto create unc-73E null alleleDepositorInsertCas9 and sgRNA against unc-73 exon21 (unc-73 Nematode)
UseCRISPRExpressionWormPromoterU6Available sinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-VGAT sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239030PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-miR30-shJAG1 #1
Plasmid#171196PurposeRetroviral vector for U6 promoter driven expression empty miR30 based shJAG1 #1 (to be used in conjunction with Phoenix packaging cells).DepositorAvailable sinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2T-U6-sgGAA
Plasmid#232724PurposeCas9 guide RNA targeting GAA repeats for A-to-G base editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpCas9 gRNA targeting GAA repeats
ExpressionMammalianAvailable sinceMarch 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2T-U6-sgCTG
Plasmid#232723PurposeSpCas9 guide RNA targeting CAG repeats for C-to-T base editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpCas9 gRNA targeting CAG repeats
ExpressionMammalianAvailable sinceMarch 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgLATS1/2-1
Plasmid#229431Purposeknockout of LATS1 and LATS2DepositorUseCRISPR and LentiviralExpressionMammalianPromoterhU6;bU6;EFSAvailable sinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
LT3GEPIR-WT1shRNA
Plasmid#220560PurposeTo inducibly knockdown WT1 or EWSR1::WT1 expressionDepositorAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCLV3Cas-LT1
Plasmid#210549PurposeBinary vector expressing the Lineage Tracing system. Cas9 expression driven by CLV3 promoter. LT1 reporterDepositorInsertCLV3p::spCas9::PEA3At::U6p::AAVS1gRNA::pHTR5::LT1::mCherrySSM
ExpressionPlantMutation2bp insertion after AAVS1 target sequence that di…Available sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFAK #1
Plasmid#198757Purposeconditional knockdown of FAKDepositorInsertshFAK #1 (PTK2 Human)
ExpressionMammalianAvailable sinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFAK #2
Plasmid#198758Purposeconditional knockdown of FAKDepositorInsertshFAK #2 (PTK2 Human)
ExpressionMammalianAvailable sinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
BoxB-MS2 adRNA (RAB7A-UAG site)
Plasmid#170138PurposeAAV vector carrying a BoxB-MS2 adRNA targeting the RAB7A transcriptDepositorInsertBoxB-RAB7A(UAG)-MS2
UseAAVExpressionMammalianPromoterHuman U6Available sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX552-mScn2a-3xV5-EF1-smFP-flag
Plasmid#182561PurposeFor mouse Nav1.2 knockin with 3xV5 at the C-terminalDepositorInsertsmouse Scn2a gRNA and 3xV5 donor DNA
smFP-flag
UseAAV and CRISPRPromoterEF1 and U6Available sinceMarch 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGMC00002
Plasmid#166719PurposesgRNA against human BAP1DepositorAvailable sinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only
