We narrowed to 10,605 results for: yeast
-
Plasmid#232742PurposeExpresses NADPH/NADP+ biosensor NAPstar6 in S. cerevisiae.DepositorInsertNAPstar6
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar4.3
Plasmid#232743PurposeExpresses NADPH/NADP+ biosensor NAPstar4.3 in S. cerevisiae.DepositorInsertNAPstar4.3
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Ndi-1/myc-His
Plasmid#127503PurposeExpresses myc-tagged yeast Ndi-1 in mammalian cellsDepositorAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstarC
Plasmid#232737PurposeExpresses control sensor NAPstarC in S. cerevisiae.DepositorInsertNAPstarC
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMVS142_pACT1_mCherry_Zif268_EBD_MCS_KAN
Plasmid#99049PurposeTranscription Factor chassis for activation domains. mCherry, Zif268 DNA binding domain, estrogen response domainDepositorInsertsExpressionYeastAvailable SinceMarch 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
DENV4 Rluc Reporter GND mutant Replicon
Plasmid#118586PurposeFor use as a positive control for translation of the Rluc gene in the transfected cells and negative control for replication.DepositorInsertDENV4 Renilla luciferase gene (Rluc) reporter replicon containing replication-defective GND mutation in the NS5 polymerase gene.
UseYeast-e. col shuttle vector prs424MutationThe conserved GDD in the NS5 polymerase gene muta…Available SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar1
Plasmid#232738PurposeExpresses NADPH/NADP+ biosensor NAPstar1 in S. cerevisiae.DepositorInsertNAPstar1
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAG416GALL-HIV-1_PR
Plasmid#203493PurposeExpresses HIV-1 protease from a GALL promoter with a URA3 markerDepositorInsertHIV-1 protease
ExpressionYeastPromoterGALLAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBKWH-Lam
Plasmid#133899PurposeNegative control. Expression of Gal4BD-Lam hybrid protein. Homology regions for recombination with pAWHDepositorAvailable SinceJune 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:mTREK-1_cryst
Plasmid#133269PurposeP. pastoris expression vector. It will generate the mouse TREK-1 channel (21-322) fused to a C-terminal GFPDepositorInsertPotassium channel subfamily K member 2 (KCNK2, TREK-1) (Kcnk2 Mouse)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationaa 21-322, K84R, Q85E, T86K, I88L, A89R, Q90A, A9…Available SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCHKU34.1-2.2
Plasmid#115534PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertPKS
ExpressionYeastAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCBS-5737
Plasmid#249326PurposeExpresses Non-targeting sgRNADepositorInsertnontargeting sgRNA
ExpressionYeastMutationN/AAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYO391
Plasmid#235751PurposeProtein expression of ScVPS38, untagged + ScVPS34, untagged + FL ScVPS15-ZZ + ZZ-FL ScVPS30DepositorInsertsTags3xTEV-ZZ and ZZ-3xTEVExpressionYeastMutationS2A and T134A, I851RPromoterGALGAPDHAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar2
Plasmid#232739PurposeExpresses NADPH/NADP+ biosensor NAPstar2 in S. cerevisiae.DepositorInsertNAPstar2
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar4
Plasmid#232741PurposeExpresses NADPH/NADP+ biosensor NAPstar4 in S. cerevisiae.DepositorInsertNAPstar4
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar7
Plasmid#232744PurposeExpresses NADPH/NADP+ biosensor NAPstar7 in S. cerevisiae.DepositorInsertNAPstar7
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-STE3pr-MFA-Igkappa-FAPoptim-STE3-TAILLESS
Plasmid#221117PurposeFAP tagged STE3-TAILLESS mutant (delta288-470 - N-terminally tagged, optimized) under the Ste3 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3-Tailless
ExpressionYeastMutationSTE3 mutant that lacks the entire C-terminal tail…PromoterSTE3Available SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS415-STE3pr-MFA-Igkappa-FAPoptim-STE3-deltaPEST
Plasmid#221118PurposeFAP tagged STE3-PEST mutant (delta413-470 - N-terminally tagged, optimized) under the Ste3 promoter with 2xMYC tag and MFA1 signal sequence to help target construct to the ERDepositorInsertMFA-IgKappa-FAPoptim-STE3-deltaPEST
ExpressionYeastMutationSTE3 mutant that lacks the PEST domain in the C-t…PromoterSTE3Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only