We narrowed to 17,698 results for: puromycin
-
Plasmid#182969PurposeStably express PalmNanoLuc in mammalian cells via the sleeping beauty transposon system.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPalmNanoLuc
ExpressionMammalianMutationN/AAvailable sinceApril 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_FLuc_loxP-PuroR
Plasmid#177866PurposeCloning Backbone for Firefly-luciferase-based EXSISERS containing loxP-sites flanked PuroR cassetteDepositorInsertFLuc-based EXSISERS
UseCRISPR, Cre/Lox, Luciferase, Synthetic Biology, a…TagsFLAGExpressionMammalianAvailable sinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV_PIG_3XHA-Ago1
Plasmid#170916PurposeExpresses 3X-HA-AGO1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAgo1 (Ago1 Mouse)
Tags3X-HAExpressionMammalianAvailable sinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
MO91-ORAI1N223A-TEV-pHluorin (ORAI1-EC-pHluorin)
Plasmid#174336PurposeThe ORAI1N223A mutant containing-TEV-pHluorin-TEV sequence in the extracellular loop 2DepositorInserthuman Orai1 (ORAI1 Human)
UseRetroviralTagspHluorin inserted in the extracellular loop 2 of …ExpressionMammalianPromoterCMVAvailable sinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP472
Plasmid#134997PurposeInterspersed Reporter. Fluorescent reporter to be used with m6A readers and writers. (8xZF binding sites + 14xGATC sites)-pMinCMV-GFPd2-RbGpA pGK-PuroR-T2A-mCh-BGHpA AAVS1 donorDepositorInsertInters. (8XZFBS 14XGATC)-pMinCMV-GFPd2-RbGpA pGK-PuroR-T2A-mCh-BGHpA AAVS1 donor
UseAAV and Synthetic BiologyExpressionMammalianAvailable sinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMP498
Plasmid#134998PurposeClustered Reporter. Fluorescent reporter to be used with m6A readers and writers. (5xZF binding sites + 63xGATC sites)-pMinCMV-GFPd2-RbGpA pGK-PuroR-T2A-mCh-BGHpA AAVS1 donorDepositorInsertClust. (5XZFBS 63XGATC)-pMinCMV-GFPd2-RbGpA pGK-PuroR-T2A-mCh-BGHpA AAVS1 donor
UseAAV and Synthetic BiologyExpressionMammalianAvailable sinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Direct-seq_lentiGuide-Puro-tRNA-Tail-8A8G
Plasmid#157984PurposeExpresses programmed gRNA scaffold from U6 promoter. Programmed gRNA scaffold for streamlined scRNA-seq in CRISPR screen (Direct-seq). 3rd generation lentiviral backbone.DepositorInsertS. pyogenes sgRNA cassette (tRNA-Tail-8A8G)
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL012_AAVS1-puro-9xTetO-pEF-H2B-mCitrine-5kb,lambda-pRSV-H2B-mCherry
Plasmid#179429PurposeDual fluorescent reporter construct with 5kb lambda spacer, upstream TRE (Tetracycline Response Element) recruitment site, arms for integration at AAVS1 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTRE-cit-5kb-mch
ExpressionMammalianPromoterpEF alpha, pRSVAvailable sinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL011_AAVS1-puro-9xTetO-pEF-H2B-mCitrine-pRSV-H2B-mCherry
Plasmid#179428PurposeDual fluorescent reporter construct with no spacer, upstream TRE (Tetracycline Response Element) recruitment site, arms for integration at AAVS1 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTRE-cit-(nospacer)-mch
ExpressionMammalianPromoterpEF alpha, pRSVAvailable sinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-PE NG
Plasmid#174554PurposeAll-in-one prime editor piggyBac transposon, NG variantDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpCas9 NG_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsSV40 NLSExpressionMammalianMutationL1111R, G1218R, E1219F, A1322R, R1335V, T1337RPromoterCAGAvailable sinceFeb. 22, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CBP core-dCas9-p300 core
Plasmid#179558Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human CBP core (aa 1084-1701) and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
GCN5 FL-dCas9-CBP core
Plasmid#179556Purposeencodes S. pyogenes dCas9 with n-terminal fusion of full length human GCN5 and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSB700 lenti gRNA Puro_zhang2.0
Plasmid#167919PurposeLentiviral vector for expressing U6 MS2-sgRNA cloning plasmidDepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
W118-1_hRSK3(RPS6KA2)_K91A_K444A
Plasmid#180385Purposelentiviral transduction of human RSK3 (RPS6KA2) gene with point mutations (K91A and K444A) that inactivate kinase activityDepositorInsertRPS6KA2_K91A/K444A (RPS6KA2 Human)
UseLentiviralExpressionMammalianMutationK91A/K444APromoterCMVAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_VPR_Puro
Plasmid#167895PurposePiggyBac compatible plasmid expressing Cas9-VPRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9-VPR
UseCRISPRAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
W118-1_hRSK3(RPS6KA2)
Plasmid#180384Purposelentiviral transduction of human RSK3 (RPS6KA2) geneDepositorAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_VPR_Puro
Plasmid#167887PurposePiggyBac compatible plasmid expressing dCas9-VPRDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCas9-VPR
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable sinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX-Egr2ASRNA
Plasmid#177737PurposeEgr2 AS-RNA lentiviral expression vectorDepositorInsertEgr2-AS-RNA
UseLentiviralExpressionMammalianAvailable sinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-dADAM17 (#1)
Plasmid#177259PurposeA knockout vector for the dog Adam17DepositorInsertA gRNA targeting the dog Adam17 gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralExpressionMammalianAvailable sinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only