We narrowed to 14,614 results for: sta
-
Plasmid#139096PurposeExpresses human codon-optimized inactive xCas9 3.7 fused to a transcriptional repressor KRAB in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertKRAB-dxCas9 3.7
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840A, A262T, R324L,S409I, E480K, E543D, M6…Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL4-eIF3B MBE3 mutant
Plasmid#133310PurposeExpression of luciferase driven by eIF3B promoter region mutated at the E-box binding motif 3DepositorInserteIF3B promoter MBE3 mutant (EIF3B Human)
UseLuciferaseExpressionMammalianMutationccacgtgacc changed to cAaAAAAaccPromotereIF3BAvailable SinceOct. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCI-TPI_WT-RAB7A_3UTR-xrRNA-4H
Plasmid#108372PurposeExpresses wild type TPI reporter; contains partial RAB7A control 3' UTR; enables detection of 5'-3' decay intermediates (xrFrag) and allows detection via northern blot (4H binding sites)DepositorInsertExpressionMammalianPromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-PIG-N3FLAG-TAF12
Plasmid#105593Purposeretrovirally express mouse TAF12 with 3*FLAG tag at N terminal, GFP marker and puro resistanceDepositorInsertfull length TAF12 with silent mutations, making it resistant to TAF12 shRNA#364 (Taf12 Mouse)
UseRetroviralTags3*FLAGExpressionMammalianMutationsilent mutations to make it resistant to the targ…PromoterMSCV-LTRAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
-
pSDS088
Plasmid#250583Purposein vivo Inverter PlasmidDepositorInsertsUseSynthetic BiologyTagsLgBiT and SmBiTExpressionBacterialAvailable SinceJune 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSG297-(Sp-gRNA)-(Sa-gRNA)-(PuroR_T2A_BFP(C>T screening))
Plasmid#239448PurposeOrthogonal dual Cas9 gRNA and BFP reporter lentivirus cassette plasmid. For use with S. pyogenes and S. aureus gRNAs and includes a BFP reporter which reports on C-to-T editing.DepositorInsertsS.p. gRNA backbone
S.a. gRNA backbone
PuroR-T2A-BFP(C>T_screening)
UseLentiviralExpressionMammalianMutationBFP: T65S, S72S, V145F, K206K, H231LPromoterEF1alpha, U6, and mU6Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D
Plasmid#115200PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S293D
Plasmid#115201PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S293D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCI-TPI_WT-TNFalpha_3UTR-xrRNA-4H
Plasmid#108374PurposeExpresses wild type TPI reporter; contains partial TNFalpha 3' UTR; enables detection of 5'-3' decay intermediates (xrFrag) and allows detection via northern blot (4H binding sites)DepositorInsertExpressionMammalianPromoterCMVAvailable SinceJune 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFastBac dual_Human full length _CDK7 (S164D, T170E)_del327-346
Plasmid#217012PurposeExpression of CDK7 in insect cellsDepositorInsertCDK7 (S164D, T170E)_del327-346 (CDK7 Human)
TagsTEV cleavable his tagExpressionInsectMutation(S164D, T170E)_del327-346Available SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291D/S293D
Plasmid#115202PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291D/S293D into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291D/S293D (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceJuly 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMCh-1540
Plasmid#82433PurposePlasmid for expression of GST-tagged human-Nematostella GW182 11W11A chimera in mammalian cellsDepositorInserths-nvGW182 11W11A chimera
TagsGSTExpressionMammalianMutationaa 1-1169 of siRNA resistant hsTNRC6A (Q8NDV7-2) …PromoterEF1AAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMCh-1538
Plasmid#82431PurposePlasmid for expression of NHA-tagged human-Nematostella GW182 11W11A chimera in mammalian cellsDepositorInserths-nvGW182 11W11A chimera
TagsNHAExpressionMammalianMutationaa 1-1169 of siRNA resistant hsTNRC6A (Q8NDV7-2) …PromoterCMVAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only