We narrowed to 37,886 results for: KAN
-
Plasmid#234107PurposeCCP expression in diverse gram-negative bacteria, with pre-cloned Golden Gate Compatible (BsaI) restriction sites to facilitate promoter swapping.DepositorInsertsfGFP
UseTagsFLAGExpressionBacterialMutationS30R/Y39N/N105T/Y145F/I171V/A206VPromoterpJ23100-BsaIAvailable sinceApril 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBC135
Plasmid#202262PurposeLevel 2 for strain-specific barcode DNA tag with bc162 through Tn7 bacterial insertion, Kanamycin selectable marker and tagBFP fluorescent markerDepositorInsertbc162
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC113
Plasmid#202275PurposeLevel 2 for strain-specific barcode DNA tag with bc140 through Tn7 bacterial insertion, Tetracyline selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc140
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC115
Plasmid#202277PurposeLevel 2 for strain-specific barcode DNA tag with bc142 through Tn7 bacterial insertion, Tetracyline selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc142
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC117
Plasmid#202278PurposeLevel 2 for strain-specific barcode DNA tag with bc144 through Tn7 bacterial insertion, Tetracyline selectable marker and GFP fluorescent markerDepositorInsertbc144
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC118
Plasmid#202279PurposeLevel 2 for strain-specific barcode DNA tag with bc145 through Tn7 bacterial insertion, Tetracyline selectable marker and GFP fluorescent markerDepositorInsertbc145
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC119
Plasmid#202280PurposeLevel 2 for strain-specific barcode DNA tag with bc146 through Tn7 bacterial insertion, Tetracyline selectable marker and GFP fluorescent markerDepositorInsertbc146
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC108
Plasmid#202247PurposeLevel 2 for strain-specific barcode DNA tag with bc135 through Tn7 bacterial insertion, Gentamicin selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc135
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC160
Plasmid#202248PurposeLevel 2 for strain-specific barcode DNA tag with bc187 through Tn7 bacterial insertion, Gentamicin selectable marker and AmCyan1 fluorescent markerDepositorInsertbc187
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC161
Plasmid#202249PurposeLevel 2 for strain-specific barcode DNA tag with bc188 through Tn7 bacterial insertion, Gentamicin selectable marker and AmCyan1 fluorescent markerDepositorInsertbc188
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC162
Plasmid#202250PurposeLevel 2 for strain-specific barcode DNA tag with bc189 through Tn7 bacterial insertion, Gentamicin selectable marker and AmCyan1 fluorescent markerDepositorInsertbc189
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC124
Plasmid#202251PurposeLevel 2 for strain-specific barcode DNA tag with bc151 through Tn7 bacterial insertion, Kanamycin selectable marker and GFP fluorescent markerDepositorInsertbc151
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC125
Plasmid#202252PurposeLevel 2 for strain-specific barcode DNA tag with bc152 through Tn7 bacterial insertion, Kanamycin selectable marker and GFP fluorescent markerDepositorInsertbc152
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC127
Plasmid#202254PurposeLevel 2 for strain-specific barcode DNA tag with bc154 through Tn7 bacterial insertion, Kanamycin selectable marker and tagRFP fluorescent markerDepositorInsertbc154
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC128
Plasmid#202255PurposeLevel 2 for strain-specific barcode DNA tag with bc155 through Tn7 bacterial insertion, Kanamycin selectable marker and tagRFP fluorescent markerDepositorInsertbc155
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC129
Plasmid#202256PurposeLevel 2 for strain-specific barcode DNA tag with bc156 through Tn7 bacterial insertion, Kanamycin selectable marker and tagRFP fluorescent markerDepositorInsertbc156
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC130
Plasmid#202257PurposeLevel 2 for strain-specific barcode DNA tag with bc157 through Tn7 bacterial insertion, Kanamycin selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc157
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC131
Plasmid#202258PurposeLevel 2 for strain-specific barcode DNA tag with bc158 through Tn7 bacterial insertion, Kanamycin selectable marker and far-red-FP fluorescent marker mPlumDepositorInsertbc158
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC132
Plasmid#202259PurposeLevel 2 for strain-specific barcode DNA tag with bc159 through Tn7 bacterial insertion, Kanamycin selectable marker and tagBFP fluorescent markerDepositorInsertbc159
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC133
Plasmid#202260PurposeLevel 2 for strain-specific barcode DNA tag with bc160 through Tn7 bacterial insertion, Kanamycin selectable marker and tagBFP fluorescent markerDepositorInsertbc160
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC134
Plasmid#202261PurposeLevel 2 for strain-specific barcode DNA tag with bc161 through Tn7 bacterial insertion, Kanamycin selectable marker and tagBFP fluorescent markerDepositorInsertbc161
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC069
Plasmid#202233PurposeLevel 2 for strain-specific barcode DNA tag with bc096 through Tn7 bacterial insertion, Gentamicin selectable marker and tagRFP fluorescent markerDepositorInsertbc096
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC070
Plasmid#202234PurposeLevel 2 for strain-specific barcode DNA tag with bc097 through Tn7 bacterial insertion, Gentamicin selectable marker and tagRFP fluorescent markerDepositorInsertbc097
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC071
Plasmid#202235PurposeLevel 2 for strain-specific barcode DNA tag with bc098 through Tn7 bacterial insertion, Gentamicin selectable marker and tagRFP fluorescent markerDepositorInsertbc098
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC072
Plasmid#202236PurposeLevel 2 for strain-specific barcode DNA tag with bc099 through Tn7 bacterial insertion, Gentamicin selectable marker and tagRFP fluorescent markerDepositorInsertbc099
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC073
Plasmid#202237PurposeLevel 2 for strain-specific barcode DNA tag with bc100 through Tn7 bacterial insertion, Gentamicin selectable marker and tagRFP fluorescent markerDepositorInsertbc100
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC079
Plasmid#202238PurposeLevel 2 for strain-specific barcode DNA tag with bc106 through Tn7 bacterial insertion, Gentamicin selectable marker and GFP fluorescent markerDepositorInsertbc106
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC080
Plasmid#202239PurposeLevel 2 for strain-specific barcode DNA tag with bc107 through Tn7 bacterial insertion, Gentamicin selectable marker and GFP fluorescent markerDepositorInsertbc107
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBC081
Plasmid#202240PurposeLevel 2 for strain-specific barcode DNA tag with bc108 through Tn7 bacterial insertion, Gentamicin selectable marker and GFP fluorescent markerDepositorInsertbc108
UseTagsExpressionBacterialMutationPromoterAvailable sinceApril 8, 2024AvailabilityAcademic Institutions and Nonprofits only