-
Plasmid#179332PurposeNT-CRISPR plasmid for a single gRNA.DepositorInsertPtac tfoX, Ptet cas9, PJ23106 acrIIA4, Ptet gRNA with sfGFP dropout
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMarch 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pST_119_LVL2 cam
Plasmid#179333PurposeNT-CRISPR plasmid for integration of multiple gRNAs.DepositorInsertPtac tfoX, Ptet cas9, PJ23106 acrIIA4, sfGFP dropout to be replaced with gRNAs
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
YE2-BE4max
Plasmid#138156PurposeC-to-T base editorDepositorInsertrAPOBEC1(YE2)-nSpCas9-UGI-UGI
UseTagsNLSExpressionMammalianMutationWithin rAPOBEC1 W90Y + R132E; within Cas9 D10APromoterCMVAvailable sinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
EE-BE4max
Plasmid#138158PurposeC-to-T base editorDepositorInsertrAPOBEC1(EE)-nSpCas9-UGI-UGI
UseTagsNLSExpressionMammalianMutationWithin rAPOBEC1 R126E + R132E; within Cas9 D10APromoterCMVAvailable sinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
YE1-BE4max-CP1028
Plasmid#138160PurposeC-to-T base editorDepositorInsertrAPOBEC1(YE1)-nSpCas9 (CP1028) -UGI-UGI
UseTagsNLSExpressionMammalianMutationWithin rAPOBEC1 W90Y + R126E; within Cas9 (CP1028…PromoterCMVAvailable sinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSExpressionMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLSB-KAN
Plasmid#166700PurposeCombined sgRNA/Cas9 pLSB vector with kanMX6 (G418) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
UseTagsExpressionYeastMutationPromoteradh15 promoter and tRNA Ser promoterAvailable sinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLSB-HYG
Plasmid#166699PurposeCombined sgRNA/Cas9 pLSB vector with hphMX6 (hygromycin) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
UseTagsExpressionYeastMutationPromoteradh15 promoter and tRNA promoterAvailable sinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLSB-NAT
Plasmid#166698PurposeCombined sgRNA/Cas9 pLSB vector with natMX6 (cloNAT) marker. Golden Gate-ready for cloning custom sgRNA sequences.DepositorInsertstRNA promoter : sgRNA cassette
adh15 promoter : Cas9 codon-optimised for S. pombe
UseTagsExpressionYeastMutationPromoteradh15 promoter and tRNA promoterAvailable sinceApril 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGES201
Plasmid#190197PurposeFor CRISPR-Cas9 mediated gene editing in soybean, soybean elongation factor 1A promoter (pM4)-Cas9, GmU6-sgRNA, Basta selectionDepositorInsertspCas9
UseCRISPRTags3xFlagExpressionPlantMutationplant-codon optimizedPromoterGlycine max elongation factor 1A(pM4)Available sinceSept. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458-AAVS1-sg
Plasmid#194721Purposepx458 with guide RNA that target hAAVS1DepositorArticleInsertCas9 (AAVS1 Streptococcus pyogenes)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDG459
Plasmid#100901PurposeSpCas9 with 2A-Puro and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-PuroRExpressionMammalianMutationPromoterCBh and U6Available sinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDG458
Plasmid#100900PurposeSpCas9 with 2A-EGFP and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAGExpressionMammalianMutationPromoterCBh and U6Available sinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
PB-SAM
Plasmid#102559PurposePiggybac transposon vector encoding dCAS9-VP64 and MS2-P65-HSF1 activator helper complex.DepositorInsertsMS2-P65-HSF1_T2A_Hygro
dCAS9(D10A, N863A)-VP64_T2A_Blast
UseCRISPR; Piggybac transposonTagsExpressionMammalianMutationD10A and N863A in Cas9 and N55K in MS2PromoterCAG and EF1AAvailable sinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
YE1-BE4max-NG
Plasmid#138159PurposeC-to-T base editorDepositorInsertrAPOBEC1(YE1)-nSpCas9(NG)-UGI-UGI
UseTagsNLSExpressionMammalianMutationWithin rAPOBEC1 W90Y + R126E; within Cas9 D10A + …PromoterCMVAvailable sinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDG330
Plasmid#100898PurposeSpCas9 with a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9 Nickase
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAGExpressionMammalianMutationPromoterCBh and U6Available sinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMP11
Plasmid#215559PurposepKD46 with constitutively expressed Cas9 and an aTc gRNA targeting the ColE1 originDepositorInsertsCas9
gRNA targeting pBR322 origin of replication
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterJ23105 and tetAvailable sinceMay 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
EC64422
Plasmid#191768PurposeCRISPR mutagenesis in Medicago truncatulaDepositorInsertSpCas9
UseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
px459 VQR
Plasmid#101715PurposesgRNA/Cas9 expression plasmid with Cas9 VQR mutations (NGA PAM)DepositorInsertSpCas9 VQR
UseTags3xFLAG-NLS and NLSExpressionMammalianMutationVQR (D1135V, R1335Q and T1337R)PromoterAvailable sinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only