We narrowed to 19,736 results for: Nov
-
Plasmid#201576PurposeExpresses a variant of human RAD23A containing mutations S172A, M173A and V195A within UBA1. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsFLAGExpressionMammalianMutationContains mutations S172A, M173A and V195AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_C344A_F354A RAD23A
Plasmid#201579PurposeExpresses a variant of human RAD23A containing mutations C344A and F354A within UBA2. Variant of plasmid pCMV6-AN-DDK_WT RAD23ADepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsFLAGExpressionMammalianMutationContains mutations C344A and F354AAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-HA_aa 1-542 POLK
Plasmid#201585PurposeExpresses the N-terminal clasp domain and catalytic domain (aa 1-542) of human DNA polymerase kappa with a HA tag in mammalian cellsDepositorInsertPolymerase kappa (POLK Human)
TagsHAExpressionMammalianMutationExpresses amino acids 1-542 of DNA polymerase kap…Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT RAD23A_aa 111-363 (delta UBL domain)
Plasmid#201460PurposeExpresses a mutant form of human RAD23A that lacks the N-terminal UBL domain. Variant of plasmid pCMV6-AN-DDK_WT RAD23A.DepositorInsertUV excision repair protein RAD23 homolog A (RAD23A Human)
TagsFLAGExpressionMammalianMutationLacks N-terminal residues 1-110Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV6-AN-DDK_WT RAD23B_aa 80-409 (delta UBL domain)
Plasmid#201545PurposeExpresses a mutant form of human RAD23B that lacks the N-terminal UBL domain. Variant of plasmid pCMV6-AN-DDK_WT RAD23BDepositorInsertUV excision repair protein RAD23 homolog B (RAD23B Human)
TagsFLAGExpressionMammalianMutationLacks N-terminal residues 1-79Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EFNB2-RBD-Fc (D62Q)
Plasmid#200979PurposeMammalian expression plasmid for soluble EFNB2 (D62Q specificity mutant) fused to IgG1 FcDepositorInsertEFNB2 (EFNB2 Human)
TagsIgG1 FcExpressionMammalianMutationSoluble Receptor-Binding Domain; D62Q mutation fo…PromoterCMVAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA28-pMa-PspCas13b crRNA-TS1
Plasmid#199459PurposeU6-driven crRNA targeting TS1 sequence (CCTCCTCGGAGAGCATCGGTGC )DepositorInsertTS1 crRNA
UseCRISPRPromotermouse U6Available SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA29-pCS2-CMV-Zebrafish NarTag (eGFP)
Plasmid#199460PurposeExpression of Zebrafish NarTag (eGFP harbors 9XMS2 in its intron) in zebrafish embryosDepositorInsertZebrafish NarTag
ExpressionMammalianPromoterCMVAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACT2-μ4
Plasmid#198176PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-4 μ4 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-4 μ4
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceApril 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-HsSmg6-del42-58-del136-152-siRNAres_K
Plasmid#146748PurposeMammalian Expression of HsSmg6-del42-58-del136-152-siRNAresDepositorInsertHsSmg6-del42-58-del136-152-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACT2-μ1A
Plasmid#198168PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-1 μ1A fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-1 μ1A
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACT2-μ2
Plasmid#198173PurposeExpression of GAL4 transcriptional activation domain (AD)-AP-2 μ2 fusion protein in yeast (yeast two-hybrid assays)DepositorInsertAP-2 μ2
TagsGAL4 transcriptional activation domain (AD) fragm…ExpressionYeastPromoterADH1Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSEVA424::tsi5
Plasmid#192960PurposeExpresses the protein Tsi51-76 for biological function studies in a broad-spectrum of organismsDepositorInserttsi5
ExpressionBacterialAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pS238D1::tse5-CT
Plasmid#192958PurposeFor expression of Tse5-CT (1169-1317) in P. putida for biological function studiesDepositorInserttse5-CT
ExpressionBacterialMutationencodes for tse5 (1169-1317)Available SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pnEA-NpM-DmeIF4Ga_617-630-DmThor_64-71-DmeIF4Ga_639-676-GB1_AD
Plasmid#148512PurposeBacterial Expression of DmeIF4Ga_617-630-DmThor_64-71-DmeIF4Ga_639-676DepositorInsertDmeIF4Ga_617-630-DmThor_64-71-DmeIF4Ga_639-676 (eIF4G1 Fly)
ExpressionBacterialAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRD424
Plasmid#178202PurposeExpression of Rok from the hns promoterDepositorInsertphns + rok
ExpressionBacterialPromoterhns promoterAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET29a(+)::D1141A
Plasmid#192963PurposeTest the activity of the putative aspartyl protease motif DPXGL-(18)-DPXGLDepositorInsertTse5_D1141A
Tags9xhis + TEV tagExpressionBacterialMutationD1141AAvailable SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET29a(+)::9xhis-Tse5
Plasmid#192962PurposeHeterologous expression of Tse5 in E. coli Lemo21 cells for purification of Tse5-CTDepositorInsertTse5
Tags9xhis + TEV tagExpressionBacterialAvailable SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRD410
Plasmid#178200PurposeExpression of sRok from the hns promoterDepositorInsertphns + srok
ExpressionBacterialPromoterhns promoterAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only