We narrowed to 15,279 results for: grn
-
Plasmid#166722PurposesgRNA against human ASNSDepositorAvailable sinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pGMC00006
Plasmid#166723PurposesgRNA against human ASNSDepositorAvailable sinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-Ly6G-miR30
Plasmid#163358PurposeLentiviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a Ly6G surface marker.DepositorAvailable sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_Lb
Plasmid#155054PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-REG1-CDS
Plasmid#136053PurposeREG1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (TATGGGATCAAGTGCCGATTC)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-CDS
Plasmid#136054PurposeCAPRIN1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTCAGCAGAACACTGGATTT)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-shPSMD2
Plasmid#125779Purposeconstitutive expression of a short-hairpin RNA targeting human PSMD2 (RNAi positive control)DepositorInsertshPSMD2 (PSMD2 Human)
UseRNAiAvailable sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgCh2-2
Plasmid#125775Purposeconstitutive expression of a guide RNA targeting an intergenic region of human chromosome 2 (CRISPR cutting control) and S. pyogenes Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgCh2-2
UseCRISPRAvailable sinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSuper-Sema4A 42-3n
Plasmid#115173PurposeshRNA against rodent Sema4ADepositorInsertshRNA targeting Sema4A
UseRNAiAvailable sinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSuper-PlexinB1
Plasmid#115174PurposeshRNA against rodent PlexinB1DepositorInsertshRNA targeting Plxnb1
UseRNAiAvailable sinceSept. 6, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSUPER.retro.puro-shMePCE
Plasmid#113536PurposeRetroviral vector designed to knock down MePCE.DepositorInsertshMePCE (MEPCE Human)
UseRetroviralAvailable sinceJuly 26, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
alpha3-nAChR shRNA (Alpha-3.29)
Plasmid#86655Purposeexpression of shRNA targeting CHRNA3DepositorAvailable sinceJune 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pICSL11061
Plasmid#68255PurposeLevel 1 Golden Gate Cassette: sgRNA cassette targeting BolC.GA4a-1 in Brassica oleraceaDepositorInsertPromoter_AtU6-26 + sgRNA_BolC.GA4a-1
UseSynthetic BiologyExpressionPlantAvailable sinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSR14.483
Plasmid#39544DepositorPublicationAvailable sinceSept. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Pdha1 Donor;3xV5 KO;Mff
Plasmid#240301PurposeKI:Pdha1 Donor:3xV5 KO:MFFDepositorInsertKI gRNA for Pdha1
UseAAVMutationNAAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Lmnb1 Donor;3xV5 KO;Mecp2
Plasmid#240298PurposeKI:Lmnb1 Donor:3xV5 KO:Mecp2DepositorInsertKI gRNA for Lmnnb1
UseAAVMutationNAAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Gria1 Donor;3xV5 KO;Dlg4
Plasmid#240294PurposeKI:Gria1 Donor:3xV5 KO:Dlg4DepositorInsertKI gRNA for Gria1
UseAAVMutationNAAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Lmnb1 Donor;3xV5 KO;Rbfox3
Plasmid#240299PurposeKI:Lmnb1 Donor:3xV5 KO:NeuNDepositorInsertKI gRNA for Lmnnb1
UseAAVMutationNAAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Sptbn4 Donor;3xV5 KO;Nfasc
Plasmid#240296PurposeKI:Sptbn4 Donor:3xV5 KO:NfascDepositorInsertKI gRNA for Sptbn4
UseAAVMutationNAAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only