pSR14.483
(Plasmid
#39544)
-
Depositing Lab
-
Depositing OrganizationUniversity of Geneva
Located in Switzerland -
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 39544 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSUPER.retro.puro
-
Backbone manufacturerOligoEngine
- Total vector size (bp) 6349
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSRP14
-
gRNA/shRNA sequenceAGGGCATACATTTCCTGCT
-
SpeciesH. sapiens (human)
-
Entrez GeneSRP14 (a.k.a. ALURBP)
- Promoter H1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XHO I (not destroyed)
- 3′ cloning site Bgl II (destroyed during cloning)
- 5′ sequencing primer CCTTGAACCTCCTCGTTCGA
- 3′ sequencing primer GTAGCGCCAAGTGCCCAGCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSR14.483 was a gift from Katharina Strub (Addgene plasmid # 39544 ; http://n2t.net/addgene:39544 ; RRID:Addgene_39544) -
For your References section:
SRP keeps polypeptides translocation-competent by slowing translation to match limiting ER-targeting sites. Lakkaraju AK, Mary C, Scherrer A, Johnson AE, Strub K. Cell. 2008 May 2;133(3):440-51. 10.1016/j.cell.2008.02.049 PubMed 18455985
Map uploaded by the depositor.