We narrowed to 13,170 results for: lic
-
Plasmid#78213PurposeSynthetic gene circuitDepositorInsertsynthetic circuit
Available SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
CSNK1G2
Plasmid#39150PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
Bxbi+PhiC31 GFP Bandpass BAC Reporter
Plasmid#78218Purposesynthetic gene circuitDepositorInsertsynthetic circuit
Available SinceMay 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBAC-T7-F7
Plasmid#234973PurposeA segment of the T7 phage genome was inserted into the artificial bacterial chromosome . The genome segment can be stably replicated in plasmid and can be genetically modified at the plasmid levelDepositorInsertT7-F7
ExpressionBacterialAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBAC-T7-F8
Plasmid#234974PurposeA segment of the T7 phage genome was inserted into the artificial bacterial chromosome . The genome segment can be stably replicated in plasmid and can be genetically modified at the plasmid levelDepositorInsertT7-F8
ExpressionBacterialAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBAC-T7-F6
Plasmid#234972PurposeA segment of the T7 phage genome was inserted into the artificial bacterial chromosome . The genome segment can be stably replicated in plasmid and can be genetically modified at the plasmid levelDepositorInsertT7-F6
ExpressionBacterialAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCTcon2-rHUH
Plasmid#235190PurposeTo display rHUH on yeast surfaceDepositorInsertrHUH
ExpressionYeastAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTetON-rHUH
Plasmid#235192PurposeTo express rHUH protein in mammalian cellsDepositorInsertrHUH
ExpressionMammalianAvailable SinceMarch 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCTcon2-rHUH(G5)
Plasmid#235188PurposeTo display rHUH(G5) on yeast surfaceDepositorInsertrHUH(G5)
ExpressionYeastAvailable SinceMarch 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDonor_AcCAST_kanR
Plasmid#127925PurposeKanamycin resistance donor for AcCASTDepositorInsertKanR
Available SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
DVA_p15A_AH
Plasmid#217602PurposeDestination vector with ampicillin resistance and p15A origin of replication. Carries A-H CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLG320
Plasmid#124370PurposeVanillic acid inducible system for expression in B. subtilisDepositorInsertgfpmut2
ExpressionBacterialPromoterPspank(V)Available SinceJan. 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_crGE
Plasmid#172933PurposeCrowding FRET sensor with mCerulean3 and mCitrine for mammalian cell expression. Linker comprises 2 helices and 3 GSG domains.DepositorInsertCrowdingSensorGE
ExpressionMammalianPromoterCMVAvailable SinceAug. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG HRP-TM
Plasmid#44441DepositorArticleInsertHorseradish peroxidase fused to the transmembrane domain of PDGFR
TagsHA tag and myc tagExpressionMammalianPromoterCAGAvailable SinceApril 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
DVA_pBR322_AG
Plasmid#217607PurposeDestination vector with ampicillin resistance and pBR322 origin of replication. Carries A-G CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
DVC_pBR322_FG
Plasmid#217600PurposeDestination vector with chloramphenicol resistance and pBR322 origin of replication. Carries F-G CIDAR MoClo overhangs for level 1 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
mito-V5-APEX2
Plasmid#72480PurposeExpresses APEX2 in mitochondriaDepositorInsertAPEX2
TagsV5ExpressionMammalianPromoterCMV promoterAvailable SinceApril 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
DVA_p15A_AF
Plasmid#217604PurposeDestination vector with ampicillin resistance and p15A origin of replication. Carries A-F CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-BirA-ER
Plasmid#20856DepositorInsertBirA-ER
ExpressionMammalianMutationC-terminal ER targeting sequence (KDEL)Available SinceMay 7, 2009AvailabilityAcademic Institutions and Nonprofits only