We narrowed to 11,083 results for: AGA
-
Plasmid#232948PurposeExpresses the RNA-binding-deficient mutant of YTHDF2 with synonymous mutations for resistance against sgYTHDF2-1-mediated knockdownDepositorInsertYTHDF2-RNA-MUT (YTHDF2 Human)
UseLentiviralMutationRNA binding mutation (K416A+R527A), synonymous mu…Available SinceMay 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(SMARCA2(46))-PGKpuroBFP-W
Plasmid#200504PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and SMARCA2DepositorAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12C/sgKras/Cre
Plasmid#99850PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDNA5-FRT/TO-eGFP-TONSL
Plasmid#221012Purposemammalian expression vector of eGFP tagged TONSL siRNA resistantDepositorInsertTONSL (TONSL Human)
TagseGFPExpressionMammalianMutationsilent mutations in TONSL: 5’-gaATtAgaTCtaTCGatga…PromoterCMVAvailable SinceJune 24, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAV-KrasG12V/sgKras/Cre
Plasmid#99854PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12V mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasWT/sgKras/Cre
Plasmid#99848PurposeExpresses Cre-recombinase, a barcoded HDR template that serves as a control for HDR into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.1)-CMV-eGFP
Plasmid#194015PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.1)
eGFP
UseAAV and CRISPRExpressionMammalianPromoterCMV and u6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13C/sgKras/Cre
Plasmid#99856PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12R/sgKras/Cre
Plasmid#99852PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13D/sgKras/Cre
Plasmid#99857PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12S/sgKras/Cre
Plasmid#99853PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12S mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
delta-BRIP1-pcDNA3.1/MycHis
Plasmid#19042DepositorTagsHis and MycExpressionMammalianMutationThis is a novel BRIP1 germline mutation that cons…Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12A/sgKras/Cre
Plasmid#99849PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13V/sgKras/Cre
Plasmid#99860PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13V mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
HK1 gRNA (BRDN0001147564)
Plasmid#77644Purpose3rd generation lentiviral gRNA plasmid targeting human HK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-CRISPRa-1-EF1a-LibVec
Plasmid#239594Purposeexpresses guide#1 to boost the expression of mouse Plxnb2, via CRISPRaDepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgPlxnb2-1 in pT4-U6-sgRNA-CMV-EGFP
Plasmid#239588Purposeexpresses guide#1 to boost the expression of mouse Plxnb2, via CRISPRaDepositorInsertsgRNA targeting TSS-upstream reagion of Plxnb2 (Plxnb2 Mouse)
UseSleeping beauty (sb) transposonExpressionMammalianPromoterhU6Available SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only