We narrowed to 15,279 results for: grn
-
Plasmid#193591PurposeRELA knockoutDepositorInsertsgRELA guide 1 (RELA Human)
UseLentiviralAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hARAF-shRNA-1
Plasmid#185370PurposeFor tetracycline-inducible mammalian expression of shRNA: GCCGTGACCAGATTATCTTTA that targets human ARAFDepositorAvailable sinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAT526
Plasmid#180513PurposePlasmid expressing mammalian codon optimized wt PlmCasX, mNeonGreen, sgRNAv1 scaffold, and restriction sites to clone in new spacersDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsCasX sgRNAv1
PlmCasX-2A-mNeonGreen
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianPromoterCAG and U6Available sinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGRHL2.1.0-gDNA
Plasmid#175863PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGRHL2 (GRHL2 Human)
UseCRISPRAvailable sinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPRv2-sgPLXNB2
Plasmid#86152PurposeLentivirus carrying Cas9/CRISPR for cut in human PLXNB2 gene exon 3DepositorInsertPlexin-B2 (PLXNB2 Human)
UseCRISPR and LentiviralAvailable sinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti-Puro-sgMARK1
Plasmid#138688PurposeExpresses a human MARK1-targeting sgRNA and Cas9DepositorAvailable sinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
S9_attL1-EGFP-C-term-attL2
Plasmid#128473PurposeEGFP entry cloneDepositorInsertEGFP entry clone
ExpressionBacterialAvailable sinceSept. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
S8_attL1-N-term-EGFP-attL2
Plasmid#128472PurposeEGFP entry clonesDepositorInsertEGFP entry clones
ExpressionBacterialAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMST-710
Plasmid#118078PurposepmbfA::gRNA1(cexA)::ttrpCDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA1 (CexA)
PromoterpmbfAAvailable sinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223 SCAF8_isoC_CRISPR resistant
Plasmid#122466PurposepDONR for Gateway cloningDepositorInsertSCAF8 isoform C CRISPR resistant (SCAF8 Human)
UseGateway CloningMutationSynonymous mutations conferring resistance to gRN…Available sinceMay 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMST-711
Plasmid#118079PurposepmbfA::gRNA2(cexA)::ttrpCDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA2 (CexA)
PromoterpmbfAAvailable sinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSiren_EGFP-shHmga2#3
Plasmid#122291PurposeKnockdown for mouse Hmga2DepositorAvailable sinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shISCU
Plasmid#102972PurposeSuppression of ISCUDepositorInsertshISCU (ISCU Human)
UseLentiviral and RNAiAvailable sinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
-
FH95pUP95PDZGW (C6)
Plasmid#74022Purposelentiviral expression of Psd95 shRNA and Psd95-EGFP fusionDepositorInsertPsd95
UseLentiviral and RNAiExpressionMammalianMutationPDZPromoterH1Available sinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLncEXP-lnc-BATE1
Plasmid#64864PurposeExpresses the longest isoform of lnc-BATE1DepositorInsertlnc-BATE1
UseRetroviralPromoterCMVAvailable sinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRVH1-hygro shStx3
Plasmid#40071DepositorInsertStx3 shRNA-1
UseRetroviralPromoterH1Available sinceOct. 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEN_hU6miR-G12-E
Plasmid#25757PurposeEntry vector with human U6 promoter driving mouse G alpha 12 miR30-based shRNA.DepositorInsertG alpha 12 miR-shRNA (Gna12 Mouse)
UseGateway CloningAvailable sinceJuly 14, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1/CFP sh-hUBE2N
Plasmid#246752PurposeMammalian and lentiviral expression of shRNA targeting human UBE2N (Ubc13)DepositorAvailable sinceMay 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pscAAV-U6-gSCR-CBh-mCherry-SV40late
Plasmid#249124Purposeexpression of gSCR (scrambled, non-targeting gRNA) and mCherryDepositorAvailable sinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only