We narrowed to 15,279 results for: grn
-
Plasmid#160779PurposeSuppress DNA2DepositorInsertshDNA2_1
UseLentiviralAvailable sinceOct. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1B POLE1_2
Plasmid#160765PurposeSuppress POLE1DepositorInsertshPOLE1_2
UseLentiviralAvailable sinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1B POLE1_1
Plasmid#160763PurposeSuppress POLE1DepositorInsertshPOLE1_1
UseLentiviralAvailable sinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_3
Plasmid#155071PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_3
Plasmid#155075PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF3B-CDS
Plasmid#136045PurposeUPF3B shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GAAGCCTTGTTCCGATCTAAT)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pELF2.1.0-gDNA
Plasmid#132454PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertELF2 (ELF2 Human)
UseCRISPRAvailable sinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSL1103
Plasmid#129526PurposepDEF-SpCas9, No Target Control Vector for CRISPRi, PbEF1a promoter, 1st GenerationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdSpCas9
UsePlasmodium, rodent-infectious speciesTagsNLS, 1xHAAvailable sinceSept. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN3
Plasmid#125773Purposeconstitutive expression of a guide RNA targeting human WRNDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgWRN3 (WRN Human)
UseCRISPRAvailable sinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDYSCKO
Plasmid#120263PurposeEmpty backbone for cloning any gRNA to be used with the canavanine co-selection systemDepositorInsertDYSCKO cassette
UseCRISPR and Synthetic BiologyPromoterSNR52Available sinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSATB1.1.0-gDNA
Plasmid#113786PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor SATB1DepositorAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFOXA3.1.0-gDNA
Plasmid#112417PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor FOXA3DepositorAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFOXO4.1.0-gDNA
Plasmid#112408PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor FOXO4DepositorAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-TdT-guide1-PGK-Puro
Plasmid#102903PurposeEBNA episome plasmid for U6 promoter-driven expression of a control gRNA targeting TdTomato sequence. Includes PGK-puro selection cassette.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTdT-guide1-PGK-Puro
UseCRISPRExpressionMammalianPromoterU6Available sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCRRNA-G0-R20
Plasmid#101818PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available sinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCRRNA-G20-R0
Plasmid#101807PurposeRepress mCherry and GFP independently, with different strengthsDepositorInsertcrRNAs targeting GFP and mCherry
UseCRISPR and Synthetic BiologyPromoterSpy 1049Available sinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMOD_C2519
Plasmid#91088PurposeModule C, Promoter: OsU3, Gene: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEsp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRPromoterOsU3Available sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSico shMAPKAPK3 human
Plasmid#85661Purposeexpression of shRNA targeting human MAPKAPK3DepositorAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_huMcl-1.2
Plasmid#85531PurposeInducible expression of guide RNA (huMcl-1.2) with fluorescent GFP reporterDepositorInserthu Mcl-1.2
UseCRISPR and LentiviralExpressionMammalianPromoterH1tAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-PM-BAF180-SH2
Plasmid#41932DepositorInsertBAF180
UseRetroviralExpressionMammalianAvailable sinceMay 10, 2013AvailabilityAcademic Institutions and Nonprofits only