We narrowed to 20,861 results for: omp
-
Plasmid#199371PurposeBacterial expression plasmid for anti-ALFA nanobody with an N-terminal His-tag and biotin acceptor peptide (Avi)DepositorInsertanti-ALFA nanobody
Tags14xHis-AviExpressionBacterialMutationWTPromoterT5-LacOAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH_blast_MCS_Nard_GFP_LAMIN
Plasmid#167340PurposeExpresses GFP fused to lamin A (LA) in mammalian cellsDepositorAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-GFP11-Actin
Plasmid#181966PurposeHuman beta actin tagged with GFP11.DepositorAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1_SPTLC1_WT
Plasmid#181920Purpose3rd generation, Inducible lentiviral plasmid for expression of human wildtype SPTLC1DepositorInsertHuman serine palmitoyltransferase, long chain base subunit 1 (SPTLC1), (SPTLC1 Human)
UseLentiviral; Mammalian expression, , doxycycline i…ExpressionMammalianPromotertight TRE promoterAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
KIF1A(1-393)-GCN4-2xmCherry-EF(C)
Plasmid#61665PurposeTandem mCherry-labeled, forced-dimeric, truncated kinesin-3 fused to EF Hand linkerDepositorInsertKIF1A(1-393)-GCN4-2xmCherry-EF(C) (KIF1A Human)
ExpressionMammalianAvailable SinceMarch 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
FH1-MGT#2-mCherry
Plasmid#164097PurposeFluorescent reporter for genetic tracing of mesenchymal Glioblastoma cell-state.DepositorInsertMGT#2-mCherry
UseLentiviral and Synthetic BiologyAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDNA4.TO-ORF57-2xCSTREP
Plasmid#136217PurposeExpresses C-terminally strep tagged Kaposi's Sarcoma Associated Herpesvirus (KSHV) ORF57DepositorInsertORF57
ExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
PNLM-pcABE
Plasmid#237618PurposePNLM-pcABE generated by pre-trained Protein-Nucleic Acid constrained Language Model exhibits high efficiency, a condensed editing window, and a shortened size.DepositorInsertecTadA(8e)-nSpCas9
UseCRISPRExpressionMammalianMutationdeleted amino acids 2-8 and 147-152PromoterpCMVAvailable SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSL1521 (pSPIN, pSC101* backbone)
Plasmid#160729PurposeSingle-plasmid V. cholerae CAST system. Encodes all proteins, crRNA, donor DNA; non-targeting crRNA has BsaI sites for cloning. Temperature-sensitive pSC101* backbone can be cured by 37 °C incubation.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP11(x7)-Actin
Plasmid#181967PurposeHuman beta actin tagged with 7 copies of GFP11.DepositorInsertGFP11(x7)-Actin (ACTB )
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDFDuet-nsp7-nsp8
Plasmid#159092PurposeCoexpression construct of Nsp7 with an N-terminal His-tag and Nsp8DepositorInsertsNSP7
NSP8
TagsHisExpressionBacterialPromoterT7Available SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNTI647 dCas9-Mxi1 TetR KanMX
Plasmid#139474PurposeIntegrates CRISPRi effector and tet-responsive regulatorDepositorInsertsdCas9-Mxi1
Tet Repressor
UseCRISPRTagsMxi1 and NLSExpressionYeastMutationD10A, H840APromoterpGPM1 and pTEF1Available SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
OPEN HLA-A*02:01-BirA
Plasmid#215569PurposeE. coli expression of BirA tagged HLA-A*02:01 containing a cysteine mutation for disulfide linkage to mutant beta-2 microglobulin.DepositorInsertOPEN HLA-A*02:01 (HLA-A Human)
TagsBirAExpressionBacterialMutationGlycine 120 to CysteinePromoterT7Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
eGFP-KCC2
Plasmid#104075Purposeexpresses rat KCC2 (b isoform) with eGFP tag at the N-terminus of KCC2DepositorInsertKCC2 (b isoform) (Slc12a5 Rat)
TagsEGFPExpressionMammalianMutationEcoR1 site in rat KCC2 was removed by silent muta…PromoterCMVAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBrain-GFP-TACC3KDP-shTACC3
Plasmid#59356PurposeKnocks down endogenous TACC3 and re-expresses knockdown-proof (RNAi-resistant) GFP-tagged human TACC3.DepositorInsertTransforming Acidic Coiled Coil protein 3 (TACC3 Human)
UseRNAiTagsGFPExpressionMammalianMutationSilent mutations in amino acids 30-33 to confer s…PromoterCMVAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBABE-EGFP-THAP11-rescue-3xFLAG
Plasmid#37000DepositorInsertTHAP11 (THAP11 Human)
UseRetroviralTags3xFLAGExpressionMammalianMutationMutations were generated at codons 273-275 conver…Available SinceMay 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
Cterminal HA WDR59 pRK5
Plasmid#46328DepositorAvailable SinceJuly 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
pDESTmycDDX17
Plasmid#19876DepositorAvailable SinceDec. 31, 2008AvailabilityAcademic Institutions and Nonprofits only