We narrowed to 22,710 results for: ARC
-
Plasmid#191861PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: CCTAGT) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pCRISPR3_BC5
Plasmid#191860PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: AGTCTA) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR3_BC4
Plasmid#191859PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: GTATGA) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR3_BC3
Plasmid#191858PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: GCATGG) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR3_BC1
Plasmid#191856PurposeBarcoded plasmid with BsaI sites to clone sgRNA. The 6-nucleotide barcode (sequence: CTTTCA) near the sgRNA insert region enables demultiplexing replicates while sequencing the sgRNA region.DepositorTypeEmpty backboneUseCRISPRAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ppst93-MCRmar-NG
Plasmid#192766PurposeExpresses NG-tagged MCRmar in Methanococcus maripaludisDepositorInsertMethyl coenzyme M reductase
UseSynthetic Biology; Heterologous expression in met…TagsFlag-Strep2Available SinceDec. 6, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
Ppst93-MCRaeo-CA
Plasmid#192765PurposeExpresses CA-tagged MCRaeo in Methanococcus maripaludisDepositorInsertMethyl coenzyme M reductase
UseSynthetic Biology; Heterologous expression in met…TagsFlag-Strep2Available SinceDec. 6, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
Ppst93-MCRaeo-NB
Plasmid#192764PurposeExpresses NB-tagged MCRaeo in Methanococcus maripaludisDepositorInsertMethyl coenzyme M reductase
UseSynthetic Biology; Heterologous expression in met…TagsFlag-Strep2Available SinceDec. 6, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
Ppst93-MCRaeo-NG
Plasmid#192763PurposeExpresses NG-tagged MCRaeo in Methanococcus maripaludisDepositorInsertMethyl coenzyme M reductase
UseSynthetic Biology; Heterologous expression in met…TagsFlag-Strep2Available SinceDec. 6, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTSK573
Plasmid#190881PurposeFor C-terminal -Halo Tagging of a gene of interest with TRP1 selection marker in yeast S. cerevisiaeDepositorInsertHaloTag
UseBacterial cloning vectorAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251::PpsbA2*::B0032::CYP110D1
Plasmid#186707PurposeCYP110D1 coding sequence under the control of PpsbA2* promoter and the BBa_B0032 RBS, for the expression in Synechocystis.DepositorInsertalr4766
UseSynthetic BiologyPromoterPpsbA2*Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251::Ptrc.x.tetO2::B0032::CYP110D1
Plasmid#186709PurposeCYP110D1 coding sequence under the control of Ptrc.x.tetO2 promoter and the BBa_B0032 RBS, for the expression in Synechocystis.DepositorInsertalr4766
UseSynthetic BiologyPromoterPtrc.x.tetO2Available SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
DpbCas12e
Plasmid#188495PurposeExpresses FLAG tagged DpbCas12eDepositorInsertCas12e
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
PlmCas12e
Plasmid#188496PurposeExpresses FLAG tagged PlmCas12eDepositorInsertCas12e
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
DpbdCas12e KRAB
Plasmid#188505PurposeExpresses FLAG tagged DpbdCas12e KRABDepositorInsertdCas12e
UseCRISPR and LentiviralExpressionMammalianMutationD672A/E769A/D935APromoterEF1aAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cas12j3
Plasmid#188497PurposeExpresses FLAG tagged Cas12j3DepositorInsertCas12j3
UseCRISPR and LentiviralExpressionMammalianPromoterEF1aAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2369-Tier1-PhCMV_KRAB
Plasmid#169571PurposeTier-1 vector encoding PhCMV-driven KRAB transsilencer domain (PhCMV-KRAB-pA).DepositorInsertPCMV-driven Kruppel associated box domain
ExpressionMammalianPromoterPhCMVAvailable SinceSept. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2341_Tier3(SB)-Puro
Plasmid#169639PurposeTier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-PuroR-pA-3'ITR)DepositorInsertPRPBSA-driven PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS1041
Plasmid#169619PurposeTier-2 vector encoding PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (A1-pA::A2-pA::PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).DepositorInsertPPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPPGKAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only