We narrowed to 60,703 results for: promoter
-
Plasmid#137131PurposeIntersectional viral expression of BFP in cells expressing Flp AND NOT CreDepositorHas ServiceAAV8InsertCoff/Fon-BFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPSt_35Spr-GFP-t35S
Plasmid#203592PurposeFully assembled Plant STARR-seq plasmid with the 35S terminator.DepositorInsertsCaMV 35S promoter + Zm00001d041672 5'UTR
eGFP
CaMV 35S terminator
ExpressionPlantAvailable SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pASPIre4
Plasmid#196656PurposeDerivative of pASPIre3. Contains SpeI restriction site within the CDS of bxb1 to enable diversification of the 5’-UTR and codons 2-16.DepositorInsertBxb1-sfGFP fusion controlled by rhamnose promoter; attB/attP-flanked discriminator; exchangable 5'-UTR and CDS (codons 1-16)
ExpressionBacterialMutationSpeI site in Bxb1 CDSPromoterrhamnose-inducible promoterAvailable SinceAug. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPtGE35
Plasmid#107999PurposeExpresses TevCas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
I-TevI nuclease and partial linker domain
UseCRISPR and Synthetic Biology; Episomal vector for…TagsCas9Available SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSCL.180
Plasmid#185001PurposeExpress -Eco1 AAVS1 editing ncRNA and gRNADepositorInsertEco1: AAVS1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationAAVS1 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.177
Plasmid#184998PurposeExpress -Eco1 EMX1 editing ncRNA and gRNADepositorInsertEco1: EMX1 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationEMX1 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSCL.175
Plasmid#184996PurposeExpress -Eco1 HEK3 editing ncRNA and gRNADepositorInsertEco1: HEK3 targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
TagsSV40NLSExpressionMammalianMutationHEK3 donor, a1/a2 length extended for 27 bpPromoterH1Available SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-kdrl:mCherry-caax
Plasmid#194287PurposeExpression plasmid for zebrafish or Danionella cerebrumDepositorInsertkdrl promoter from Addgene plasmid # 78687 (kdrl Zebrafish)
UseZebrafish or danionella cerebrum expressionTagsmCherryCAAX from the Tol2kit (Kwan et al., 2007)Promoterkdrl(flk1)Available SinceJan. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_1-560 USP7
Plasmid#131244PurposeMammalian expression of N-terminally Myc-tagged USP7, minus the UBL domainsDepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianMutationExpresses USP7 amino acids 1 - 560. This truncati…Available SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_1-205 USP7
Plasmid#131245PurposeMammalian expression of the USP7 TRAF-like domain with an N-terminal Myc tag.DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianMutationExpresses a mutant form of our pcDNA3.1-N-Myc_1-5…Available SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Dub3 mouse
Plasmid#72682Purposemammalian expression of mouse Dub3DepositorAvailable SinceSept. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pbZIP9:GFP-GUS
Plasmid#172483PurposeGFP-GUS driven by the bZIP9 promoterDepositorAvailable SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
EEF1A2 in pENTR
Plasmid#216585Purposegateway cloning donor vector containing EEF1A2DepositorInsertEEF1A2 (EEF1A2 Human)
UseGateway CloningAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest-1.7kbfabp6-eGFP-pA-CrymCherry
Plasmid#159088PurposeLR construct using backbone with Cry:mCherry insert to identify fish with transgene, and with p5E-1.7kbfabp6, pME-eGFP, and p3E-pA insertsDepositorInsertsUseFluorescent reporterPromoter1.7kb fabp6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn-PdCO-EGFP-WPRE
Plasmid#198513PurposeExpresses optimized PdCO in frame with EGFP under control of human synapsin1 promotor.DepositorHas ServiceAAV1 and AAV5InsertPdCO
UseAAVTagsEGFP and Rho1D4ExpressionMammalianPromoterhSyn1Available SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Con/Foff 2.0-BFP
Plasmid#137130PurposeIntersectional viral expression of BFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-BFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationn/aPromoterEF1aAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmRNA-EGFP-A120
Plasmid#225903PurposeIn vitro transcription of cap-dependently translated mRNA encoding EGFP.DepositorInsertsA-inserted T7 class III Φ6.5 promoter
EGFP
2x β-globin UTR
poly(A) tail
UseSynthetic Biology; Mrna preparationExpressionMammalianAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
KG#121
Plasmid#110879PurposeExpresses the C. elegans unc-31 cDNA pan-neuronallyDepositorInsertsrab-3 promoter
unc-31 cDNA
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
ExpressionBacterialMutationMissing first 408bpAvailable SinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
E2_RPS5ADIPS
Plasmid#248053PurposeGateway CloningDepositorInsertArabidopsis thaliana RPS5A promoter
ExpressionPlantAvailable SinceJune 3, 2026AvailabilityAcademic Institutions and Nonprofits only