We narrowed to 11,984 results for: SOM
-
Plasmid#67744PurposePr promoter expressing a deGFP that is missing a ribosomal binding siteDepositorInsertdeGFP-T500
UseSynthetic BiologyExpressionBacterialPromoterOR2-OR1-PrAvailable SinceAug. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCALNL_Ch10
Plasmid#81224PurposepCALNL reporter contains two target sites consisting of PAM Cas9 site-gix psuedo site-Cas9 site-PAM that match region in PCDH15 locus on chromosome 10DepositorInsertgix-Neo-gix deletion cassette upstream of EGFP
ExpressionMammalianPromoterpCBaAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
PcDNA-DEST53-CypB-Del4 N-term GFP
Plasmid#36137DepositorInsertcyclophilin B (PPIB Human)
TagsGFPExpressionMammalianMutationcontains amino acids 42-216 of cyclophilin BPromoterCMVAvailable SinceSept. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
YEE_GFP
Plasmid#228184PurposeYeast episomal expression vector with type '234' GFP drop out site. For use in assembling protein expression cassettes via golden gate assembly.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
YEE_RFP
Plasmid#228185PurposeYeast episomal expression vector with type '234' RFP drop out site. For use in assembling protein expression cassettes via golden gate assembly.DepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-22b(+) pCopA sfgfp
Plasmid#226374PurposePlasmid carries copper sensor circuit genes for whole-cell sensing of copper ions with native RBS (ribosome binding site).DepositorInsertsfGFP
Tags6x HisTagExpressionBacterialPromoterpCopAAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
mCherry-GFP-SNX9
Plasmid#170551PurposeTo monitor the turnover of SNX9 in lysosomesDepositorInsertSNX9 (SNX9 Human)
UseRetroviralTagsSNX9 in tandem with mCherry and GFPExpressionMammalianAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
TCT-Universal plasmid
Plasmid#221852PurposeA universal plasmid for expressing any protein with TetraCysteine motifDepositorInsertTetra Cysteine tag
ExpressionBacterialMutationNoAvailable SinceAug. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
ClhN-pADH3-Snf7-4V5-APEX2-URA
Plasmid#207065PurposeModerate overexpression of Snf7-4V5-APEX2 under ADH3 promoter. Marker for late endosomes. Only partially functional.DepositorInsertSnf7
Tags4xV5-APEX2ExpressionYeastPromoterpADH3Available SinceMarch 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLPS1
Plasmid#209992PurposeContains Level 0 Part: Ribosome binding site (RB0034) for the construction of Level 1 plasmidsDepositorInsertRBS (RB0034)
ExpressionBacterialAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28-RPL3-191~307-mEGFP(A206K)-TwStrep
Plasmid#208626Purposefor E. coli expression of truncated human RPL3 (ENST00000216146), aa191~307, fused with mEGFP(A206K) and Twin Strep tagDepositorInserthuman RPL3 (ENST00000216146) aa 191~307 (RPL3 Human)
Tags6xHis, Twin Strep, and mEGFP(A206K)ExpressionBacterialMutationonly aa 191~307, other residues not includedPromoterT7Available SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28-RPL3-299~398-mEGFP(A206K)-TwStrep
Plasmid#208627Purposefor E. coli expression of truncated human RPL3 (ENST00000216146), aa299~398, fused with mEGFP(A206K) and Twin Strep tagDepositorInserthuman RPL3 (ENST00000216146) aa 299~398 (RPL3 Human)
Tags6xHis, Twin Strep, and mEGFP(A206K)ExpressionBacterialMutationonly aa 299~398, other residues not includedPromoterT7Available SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28-RPL3-212~285-mEGFP(A206K)-TwStrep
Plasmid#208629Purposefor E. coli expression of truncated human RPL3 (ENST00000216146), aa212~285, fused with mEGFP(A206K) and Twin Strep tagDepositorInserthuman RPL3 (ENST00000216146) aa 212~285 (RPL3 Human)
Tags6xHis, Twin Strep, and mEGFP(A206K)ExpressionBacterialMutationonly aa 212~285, other residues not includedPromoterT7Available SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
SEC7-2EGFP-ter-NAT
Plasmid#184764PurposeMarker for yeast late Golgi/early endosome . Integration of 2xGFP tag at SEC7 C terminus. Uses antibiotic resistance marker natMX6.DepositorAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
SEC7-2Katushka-ter-Hygromycin
Plasmid#184772PurposeRed marker for yeast late Golgi/early endosome. Integration of 2xKatushka tag at SEC7 C terminus. Uses antibiotic resistance marker hphMX6.DepositorAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP.N3-myc-SLC35A2
Plasmid#186285Purposetransient expression of N-terminal myc tagged SLC35A2 isoform c/UGT1 in mammalian cellsDepositorAvailable SinceJune 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lmajor_gp63_10_0460_P460G_D463N_S465A
Plasmid#171645PurposeExpression of L. major glcyoprotein-63 (P460G_D463N_S465A) with substrate binding site mutations from chromosome 10 in mammalian cellsDepositorInsertLmjF.10.0460 P460G D463N S465A
TagsMyc-HisExpressionMammalianMutationP460G; D463N; S465AAvailable SinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJC8
Plasmid#170757PurposeCo-express in mammalian cells two target proteins C-terminally fused to V5 and FLAG tags respectively, using an internal ribosome entry site and two multi-cloning sites.DepositorTypeEmpty backboneTagssite 1- V5 tag and site 2- FLAG tagExpressionMammalianPromoterCMVAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
MYMH 67
Plasmid#138048PurposeEncodes Ribosome Binding Site (RBS) variant using GFP as a reporter geneDepositorInsertpSEVA-331Bb-11AT-GFP
ExpressionBacterialMutationAAA GAG GAG ATAAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only