We narrowed to 17,160 results for: REV
-
Plasmid#239374PurposeGST-Las17 (300-422) P387ADepositorInsertLas17 (amino acids 300-422)
TagsGSTExpressionBacterialMutationProline 387 to AlanineAvailable SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
VAMP3(S48E)-mCherry
Plasmid#193637PurposeExpresses S48E phosphomimetic VAMP3 fused to mCherryDepositorAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc hk/P-RFA3-pCDFDuet
Plasmid#240743PurposeOver-express his(10)-PKA kinase motif-PreScission protease site-Sc RFA3 in E. coliDepositorInserthk/P-RFA3 (RFA3 Budding Yeast)
TagsHis(10) followed by PKA kinase motif follwed by P…ExpressionBacterialAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc RFA[1+2]-pET
Plasmid#240742PurposeOver-express Sc RFA1 & RFA2 in E. coliDepositorAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
PKA1279
Plasmid#239375PurposeGST-Las17 (300-422) P388ADepositorInsertLas17 (amino acids 300-422)
TagsGSTExpressionBacterialMutationProline 388 to AlanineAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
PKA1337
Plasmid#239376PurposeGST-Las17 (300-422) RR(319,322)AA, RR(349,350)AA, and RR(382,383)AADepositorInsertLas17 (amino acids 300-422)
TagsGSTExpressionMammalianMutationRR(319,322)AA, RR(349,350)AA, and RR(382,383)AAAvailable SinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc FLAG-S6-RFC1-pRS405/GAL-L
Plasmid#239473PurposeOverexpress Sc FLAG-S6-RFC1 in yeast (integrated)DepositorAvailable SinceJune 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 P+
Plasmid#231872PurposeBacterial expression of N-terminally 6His tagged Gcn4 P+DepositorInsertGcn4 P+
Tags6xHis, TEV cleavage siteExpressionBacterialMutationS122P, T131F, A141P, E143DPromoterT7Available SinceMarch 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-Monbr-Sox-like
Plasmid#231530PurposeExpresses Monsiga brevicolis full-length Sox-like in mammalian cells, for lentivirus generationDepositorInsertSox-like
UseLentiviralAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 R3 W
Plasmid#231876PurposeBacterial expression of N-terminally 6His tagged Gcn4 R3 WDepositorInsertGcn4 R3 W
Tags6xHis, TEV cleavage siteExpressionBacterialMutationD103R, N126W, D133R, K143RPromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDest17_Gcn4 L123A+
Plasmid#231869PurposeBacterial expression of N-terminally 6His tagged Gcn4 L123A+DepositorInsertGcn4 L123A+
Tags6xHis, TEV cleavage siteExpressionBacterialMutationL123APromoterT7Available SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only