We narrowed to 14,203 results for: cas9
-
Plasmid#194351PurposeCRISPR-Cas9 multiplexing acceptor clone with BsaI cutterDepositorInsertpcoCas9
ExpressionPlantPromoterRPS5AAvailable sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pECNUS_MP01
Plasmid#194350PurposeCRISPR-Cas9 multiplexing acceptor clone with BpiI cutterDepositorInsertpcoCas9, FAST-Red
ExpressionPlantPromoterRPS5AAvailable sinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAIO3
Plasmid#137844PurposeCas9 and gRNA expression plasmid for P. falciparum; no selection in parasites.DepositorTypeEmpty backboneUseCRISPRAvailable sinceApril 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSG297-(Sp-gRNA)-(Sa-gRNA)-(PuroR_T2A_BFP(C>T screening))
Plasmid#239448PurposeOrthogonal dual Cas9 gRNA and BFP reporter lentivirus cassette plasmid. For use with S. pyogenes and S. aureus gRNAs and includes a BFP reporter which reports on C-to-T editing.DepositorInsertsS.p. gRNA backbone
S.a. gRNA backbone
PuroR-T2A-BFP(C>T_screening)
UseLentiviralExpressionMammalianMutationBFP: T65S, S72S, V145F, K206K, H231LPromoterEF1alpha, U6, and mU6Available sinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX458-sgTSC2
Plasmid#128098PurposeCRISPR gRNA against human TSC2 with Cas9 from S. pyogenes and 2A-EGFPDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA against human TSC2 (TSC2 Human)
UseCRISPRExpressionMammalianPromoterhU6Available sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRosa26-4xInsulator (JP6)
Plasmid#99627PurposeIfgMosaic acceptor vector for Classical or Cas9 Gene targeting of the Rosa26 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGt(Rosa)26Sor (Gt(ROSA)26Sor Mouse)
UseMouse TargetingAvailable sinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEM-HaloTag-UBF
Plasmid#247351PurposeCRISPR/Cas9 donor plasmid to tag human UBF with Halo tagDepositorAvailable sinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEM-mAID-RPA194
Plasmid#247355PurposeCRISPR/Cas9 donor plasmid to tag human RPA194 with mAIDDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRPA194 (POLR1A) (POLR1A Human)
UseCRISPRTagsmAIDAvailable sinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEM-HaloTag-RPA194
Plasmid#247353PurposeCRISPR/Cas9 donor plasmid to tag human RPA194 with Halo tagDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertRPA194 (POLR1A) (POLR1A Human)
UseCRISPRTagsHaloTagAvailable sinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
ULK1 sgRNA
Plasmid#207559PurposepX330 expressing Cas9 and a sgRNA targeting the ULK1 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCCAGCCAGGCCAGAAAGGTC
ExpressionMammalianPromoterCMV and U6Available sinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
ATG5 sgRNA
Plasmid#207555PurposepX330 expressing Cas9 and a sgRNA targeting the ATG5 locusDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertAACTTGTTTCACGCTATATC
ExpressionMammalianPromoterCMV and U6Available sinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGGGGAGCAGATGGACCCTAC
ExpressionMammalianPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Drosha_1
Plasmid#79860PurposeCRISPR/Cas9 DROSHADepositorInsertsgRNA Drosha
UseCRISPR and Mouse TargetingExpressionBacterial and MammalianAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Drosha_2
Plasmid#79861PurposeCRISPR/Cas9 DROSHADepositorInsertsgRNA Drosha
UseCRISPR and Mouse TargetingExpressionBacterial and MammalianAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-sgRNA_Drosha_4
Plasmid#79863PurposeCRISPR/Cas9 DROSHADepositorInsertsgRNA Drosha
UseCRISPR and Mouse TargetingExpressionBacterial and MammalianAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_SDHB
Plasmid#177981Purposelentiviral vector expressing Cas9 and a sgRNA targeting SDHBDepositorInsertsgRNA targeting SDHB (SDHB Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
px330-GAPDH
Plasmid#136940PurposeNHEJ assay. sgRNA/Cas9 plasmid. Target DSB at human GAPDH; induce CD4+ deletion rearrangement by pairing w/ px330-CD4DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting GAPDH (GAPDH Human)
UseCRISPRExpressionMammalianAvailable sinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
px330-CD4
Plasmid#136938PurposeNHEJ assay. sgRNA/Cas9 plasmid. Target DSB at human CD4; induce CD4+ deletion rearrangement by pairing w/ px330-GAPDHDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA targeting CD4 (CD4 Human)
UseCRISPRExpressionMammalianAvailable sinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
LentiCRISPR-sgUFSP2
Plasmid#86134PurposeLentiviral vector expressing Cas9 and an sgRNA targeting UFSP2DepositorAvailable sinceMay 15, 2017AvailabilityAcademic Institutions and Nonprofits only