We narrowed to 17,160 results for: REV
-
Plasmid#252971PurposeEncodes S. cerevisiae MYC Tag-Aga2-linker as a Type 3a part to be used in the yeast secretion/display (YSD2.0) MoClo toolkit to create fusions of proteins of interest to the C-terminus of Aga2DepositorInsertAga2
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD521
Plasmid#253006PurposeEncodes S. cerevisiae SEC4 as a Type 3 part to be used in the yeast secretion/display (YSD2.0) extension of the MoClo yeast toolkit (YTK)DepositorInsertSEC4
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD522
Plasmid#253007PurposeEncodes S. cerevisiae CWH41 as a Type 3 part to be used in the yeast secretion/display (YSD2.0) extension of the MoClo yeast toolkit (YTK)DepositorInsertCWH41
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD523
Plasmid#253008PurposeEncodes S. cerevisiae SEC16 as a Type 3 part to be used in the yeast secretion/display (YSD2.0) extension of the MoClo yeast toolkit (YTK)DepositorInsertSEC16
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD503
Plasmid#252988PurposeEncodes S. cerevisiae ERV29 as a Type 3 part to be used in the yeast secretion/display (YSD2.0) extension of the MoClo yeast toolkit (YTK)DepositorInsertERV29
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD519
Plasmid#253004PurposeEncodes S. cerevisiae SRP54 as a Type 3 part to be used in the yeast secretion/display (YSD2.0) extension of the MoClo yeast toolkit (YTK)DepositorInsertSRP54
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD520
Plasmid#253005PurposeEncodes S. cerevisiae MNS1 as a Type 3 part to be used in the yeast secretion/display (YSD2.0) extension of the MoClo yeast toolkit (YTK)DepositorInsertMNS1
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD047
Plasmid#252963PurposeEncodes S. cerevisiae Pir2 anchor-linker-MYC Tag as a Type 3a' part to be used in the yeast secretion/display (YSD2.0) extension of the MoClo yeast toolkit (YTK)DepositorInsertPir
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD051
Plasmid#252964PurposeEncodes S. cerevisiae Aga2-(NoTag)-linker as a Type 3a' part to be used in the yeast secretion/display (YSD2.0) MoClo toolkit to create fusions of proteins of interest to the C-terminus of Aga2DepositorInsertAga2
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD045
Plasmid#252961PurposeEncodes S. cerevisiae Pir anchor-linker-HA Tag as a Type 3a' part to be used in the yeast secretion/display (YSD2.0) extension of the MoClo yeast toolkit (YTK)DepositorInsertPir
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYSD046
Plasmid#252962PurposeEncodes S. cerevisiae Pir anchor-linker-2xFLAG Tag as a Type 3a' part to be used in the yeast secretion/display (YSD2.0) extension of the MoClo yeast toolkit (YTK)DepositorInsertPir
ExpressionBacterialAvailable SinceApril 22, 2026AvailabilityAcademic Institutions and Nonprofits only -
pVG173
Plasmid#251208PurposeExpresses a version of light-inducible transcription factor EL222 (Gly80Arg) under a strong constitutive PGK1prDepositorInsertEL222 codon-optimized for budding yeast
UseSynthetic BiologyExpressionBacterial and YeastMutationGly80ArgPromoterPGK1prAvailable SinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
ADH1pro_YRR1_SIR4
Plasmid#190585PurposeTranscription factor tagged with Sir4 used for Calling Cards experiments for binding measurementDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
Sc FLAG-kin-mec3-pRSFDuet
Plasmid#240741PurposeOver-express Sc FLAG-PKA kinase motif-mec3 in E. coliDepositorInsertFLAG-kin-mec3 (MEC3 Budding Yeast)
Tags3X FLAG followed by PKA kinase motifExpressionBacterialAvailable SinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAL007
Plasmid#233866PurposeMoClo-YTK URA multigene plasmid with MCS; NS3 systems; pTDH3-LexA-NLS-NS3-V1-VP48-2xOaf1-tADH1; lexAO6-pLEU2m-MCS-tENO2DepositorInsertpTDH3-LexA-NLS-NS3-V1-VP48-2xOaf1-tADH1; lexAO6-pLEU2m-MCS-tENO2
ExpressionYeastAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAIP4_3ONH
Plasmid#234179PurposeHeterologous protein expression of ubiquitin-activating enzyme E1-like in Escherichia coliDepositorAvailable SinceMarch 6, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only