We narrowed to 16,217 results for: GRN;
-
Plasmid#132440PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF3 (ZNF3 Human)
UseCRISPRAvailable SinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTSHZ1.1.0-gDNA
Plasmid#132434PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertTSHZ1 (TSHZ1 Human)
UseCRISPRAvailable SinceDec. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
C41m
Plasmid#120974PurposeMoClo golden gate assembly CD part for dCas9 (Catalytically-inactive S. pyogenes Cas9, for gRNA-targeted repression). Please see Supplemental Documents for annotated Genbank file.DepositorInsertdCas9
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR_Wheat_live_Cas9
Plasmid#126880PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and BpiI sites for sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shGFP
Plasmid#110421PurposeshGFP control, silence GFP gene, doxycycline inducible, puromycin selectionDepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHTganA-Cpf1
Plasmid#158647PurposeConstitutive transcription of FnCpf1 and ganA crRNADepositorInsertCpf1, ganA crRNA
UseCRISPR and Synthetic Biology; Shuttle vector baci…ExpressionBacterialPromoterP43Available SinceOct. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pADsacA
Plasmid#158649PurposeConstitutive transcription of sacA crRNA and GFPDepositorInsertsacA crRNA
UseCRISPR and Synthetic Biology; Shuttle vector baci…ExpressionBacterialPromoterPvegAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shLuc
Plasmid#110422PurposeshLuc control, silence Luc gene, doxycycline inducible, puromycin selectionDepositorInsertLuciferase
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVX-H3.3-G34R-FLAG-BFP
Plasmid#209440PurposeLentiviral packagable plasmid expressing FLAGGED human histone mutant H3.3-G34R with BFPDepositorInsertH3.3-G34R
ExpressionMammalianMutationG34RAvailable SinceNov. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
BII-gR-PnTW
Plasmid#133356PurposePiggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications) coexpressed with tdTomato-NLSDepositorInserttdTomato-NLS
TagsHA-tagged tdTomatoExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1B
Plasmid#185383PurposeFor mammalian expression of shRNA: GAGCAGAAGAGGATGAATTTA that targets human PPM1BDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
cTRE-GFP-miR30_shPten.1523
Plasmid#135667PurposeIntroduce Dox-inducible (TRE promoter) GFP cDNA plus miR30-embedded shPten into (ES) cells by recombination-mediated cassette exchangeDepositorInsertshPten
UseMouse TargetingAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
linker-T2A-NTRv2-linker-P2A-mNeonGreen-CAAX ORF3
Plasmid#241194PurposeMiddle entry vector for mini-Golden subcloning platform; NTRv2; mNeonGreenDepositorInsertNTRv2; mNeonGreen
UseMini-goldenMutationTCGC linkerAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
linker-T2A-NTRv2-linker-P2A-mNeonGreen-CAAX ORF2
Plasmid#241193PurposeMiddle entry vector for mini-Golden subcloning platform; NTRv2; mNeonGreenDepositorInsertNTRv2; mNeonGreen
UseMini-goldenMutationTCGC linkerAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
linker-T2A-NTRv2-linker-P2A-mNeonGreen-CAAX ORF1
Plasmid#241192PurposeMiddle entry vector for mini-Golden subcloning platform; NTRv2; mNeonGreenDepositorInsertNTRv2; mNeonGreen
UseMini-goldenMutationTCGC linkerAvailable SinceAug. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMC-ME_T2A-BFP-P2A-NTRv2-pA ORF-1
Plasmid#200539Purposemini circle middle entry plasmid for T2A- BFP- P2A- ntr version 2- pA (ORF 1) with flanking BsaI cut sitesDepositorInsertBFP, NTRv2
UseMini-goldenAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMC-ME_T2A-BFP-P2A-NTRv2-pA ORF-2
Plasmid#200540Purposemini circle middle entry plasmid for T2A- BFP- P2A- ntr version 2- pA (ORF 2) with flanking BsaI cut sitesDepositorInsertBFP, NTRv2
UseMini-goldenAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMC-ME_T2A-BFP-P2A-NTRv2-pA ORF-3
Plasmid#200541Purposemini circle middle entry plasmid for T2A- BFP- P2A- ntr version 2- pA (ORF 3) with flanking BsaI cut sitesDepositorInsertBFP, NTRv2
UseMini-goldenAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMC-ME_CreER-pA-FRT-acry:venus-pA-FRT
Plasmid#200543Purposemini circle middle entry plasmid for CreER-pA-FRT-acry:venus-pA-FRT with flanking BsaI cut sitesDepositorInsertCreER
UseMini-goldenAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMC-ME_CreER-pA-FRT-acry:mCherry-pA-FRT
Plasmid#200544Purposemini circle middle entry plasmid for CreER-pA-FRT-acry: mCherry -pA-FRT with flanking BsaI cut sitesDepositorInsertCreER, mCherry
UseMini-goldenAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only