176,436 results
-
Plasmid#122944PurposeMS2 coat protein-modified lentiviral packaging plasmid for packaging mRNA with an MS2 aptamer into lentivirus-like particlesDepositorInsertNC-MCP (MS2 coat protein) fusion protein in Gag
UseLentiviralExpressionMammalianMutationD64VAvailable sinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET24b-APEX2
Plasmid#111702PurposeFor IPTG-inducible expression of APEX2 in E. coliDepositorInsertAPEX2
Tags6xHis and V5ExpressionBacterialPromoterT7 promoterAvailable sinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330 spCas9-mSA
Plasmid#113096PurposepX330 vector carrying spCas9-mSA for gene editing in mammalian cell linesDepositorInsertCAS9-MSA
UseSynthetic BiologyTagsMSA (monomeric streptavidinMutationnoneAvailable sinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX459V2.0-HypaCas9
Plasmid#108294PurposepX459 V2.0 (Plasmid #62988) with the N692A, M694A, Q695A, and H698A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable sinceJuly 20, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pACYC-Taq
Plasmid#102793PurposeExpresses Taq DNA polymerase under WT T7 promoterDepositorInsertTaq DNA polymerase
ExpressionBacterialAvailable sinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pWS158
Plasmid#90517PurposeCas9 gap repair vector - URA3DepositorInsertCas9
UseCRISPRExpressionYeastAvailable sinceOct. 19, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSFV-Helper1
Plasmid#92073PurposeThis is a plasmid for transcription of defective helper RNA, providing structural Semliki forest virus (SFV) proteins to package recombinant SFV genomes into virus like particles.DepositorInsertcDNA of SFV genome with deletion removing the nonstructural SFV proteins and also the viral RNA packaging signal.
UseHelper plasmid, for run-off transcription and rna…Available sinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET-CjCas9
Plasmid#89754PurposeExpression of CjCas9 with His tag in E.coliDepositorInsertCjCas9
UseCRISPRTags6XHis, HA, and SV40 NLSExpressionBacterialPromoterT7Available sinceMay 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1-3xFLAG-V5-ccdB
Plasmid#87064PurposeMammalian Gateway-compatible expression vector backbone with an N-terminal 3xFLAG-V5 tagDepositorTypeEmpty backboneTags3xFLAG-V5ExpressionMammalianAvailable sinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by