We narrowed to 17,152 results for: igh
-
Plasmid#46617DepositorAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only
-
pFBP_2xNbLYS1::LUZ
Plasmid#189918PurposeBinary vector for Agrobacterium-mediated transient expression of a bioluminescent reporter for assessing immune activation in Nicotiana benthamiana by transiently expressed plant immune receptors.DepositorInsertpLHB1B1:NnCPH:tSlH4, p35S_Short_TMV 5':AsNpga:tAtug7, pAtUbi1:NnH3H:tAtuNos, pCmYLCV:NnHisps:tHsp, p2xNbLYS1:NnLuz:tAtuOcs
UseLuciferaseExpressionPlantPromoterVariousAvailable SinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPlin5-mScarlet3-H (aka mYongHong)
Plasmid#239408PurposeExpresses Plin5-mScarlet3-H in mammalian cellsDepositorInsertPlin5 (PLIN5 Human)
TagsmScarlet3-H (aka mYongHong)ExpressionMammalianMutationM163H in mScarlet3PromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR(RfxCas13d)-CAG-hfCas13d-pa
Plasmid#233036PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d from a CAG promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST
Plasmid#174007PurposeCre dependent co-expression of jGCaMP8s and soma-targeted ChrimsonR under the control of an hSyn promoter. jGCaMP8s and ChrimsonR are separated by cleavable peptide sequence P2A.DepositorHas ServiceAAV9InsertjGCaMP8s-P2A-ChrimsonR-ST
UseAAVTags6xHis and soma targeting motifPromoterhSynAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
phCMV-GALV-MTR
Plasmid#163612PurposeRetro and Lentiviral transduction of primary human germinal center B cellsDepositorInsertGaLV MTR envelope
ExpressionMammalianPromoterCMVAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro
Plasmid#71236PurposeExpress sgRNA and dCas9-KRAB from lentiviral vectorDepositorInsertshumanized dCas9-KRAB T2A Puro
sgRNA
UseCRISPR and LentiviralTagsFlagMutationD10A and H840AAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-HF1
Plasmid#138556PurposeExpresses human codon-optimized high-fidelity SpCas9 and blasticidin resistance: EFS promoter-SpCas9-HF1-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-HF1
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926APromoterEFSAvailable SinceJune 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TripleColour-StAR
Plasmid#222695PurposeCompetition assayDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsTagBFP, miRFP703, dTomatoExpressionMammalianMutationPGK, TagBFP, dTomato without BsmBI cutsiteAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-aBEST
Plasmid#131464PurposeExpression of a Streptomyces codon optimized Cas9n-tadA fusion protein in pGM1190. A to G base editor for actinomycetesDepositorInsertsStreptomyces codon optimized spCas9n (D10A)
streptomyces codon optimized tadA
UseCRISPR and Synthetic BiologyPromotertipAAvailable SinceNov. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMVS102_P3-GFP-NATMX6
Plasmid#99048PurposeEGFP reporter with six binding sites for the Zif268 DNA binding domainDepositorInsertsMcIsaac 2014 P3 promoter
eGFP
clonNAT resistance
ExpressionYeastMutationGAL1 promoter with 4 GAL4 sites removed and repla…PromoterMcIsaac 2014 P3 promoterAvailable SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX-TeLC-P2A-dTomato
Plasmid#159102PurposeCre-dependent tetanus toxin light chain construct with nuclear-localized dTomato fluorophore for conditional silencing of neurons.DepositorInsertTeLC-P2A-NLS-dTomato
UseAAVPromoterhSynapsinAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSL1142 (pSPIN, pBBR1 backbone)
Plasmid#160730PurposeSingle-plasmid V. cholerae CAST system, encodes all proteins, crRNA, and donor DNA. Entry vector encodes non-targeting crRNA, with BsaI sites for spacer cloning. pBBR1 backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131-STU-Lb
Plasmid#138096PurposeGolden Gate entry vector for 1st crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134-STU-Lb
Plasmid#138105PurposeGolden Gate entry vector for 4th crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133-STU-Lb
Plasmid#138102PurposeGolden Gate entry vector for 3rd crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132-STU-Lb
Plasmid#138099PurposeGolden Gate entry vector for 2nd crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ144-ZmUbi-pT
Plasmid#138108PurposeGolden Gate recipient and Gateway entry vector; assembly of 4 gRNAs driven by Zea mays Ubi promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ142-ZmUbi
Plasmid#138106PurposeGolden Gate recipient and Gateway entry vector; assembly of 2 gRNAs driven by Zea mays Ubi promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only