We narrowed to 17,163 results for: IGH@;
-
Plasmid#174007PurposeCre dependent co-expression of jGCaMP8s and soma-targeted ChrimsonR under the control of an hSyn promoter. jGCaMP8s and ChrimsonR are separated by cleavable peptide sequence P2A.DepositorHas ServiceAAV9InsertjGCaMP8s-P2A-ChrimsonR-ST
UseAAVTags6xHis and soma targeting motifPromoterhSynAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR(RfxCas13d)-CAG-hfCas13d-pa
Plasmid#233036PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d from a CAG promoterDepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-FLEX-TeLC-P2A-dTomato
Plasmid#159102PurposeCre-dependent tetanus toxin light chain construct with nuclear-localized dTomato fluorophore for conditional silencing of neurons.DepositorInsertTeLC-P2A-NLS-dTomato
UseAAVPromoterhSynapsinAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TripleColour-StAR
Plasmid#222695PurposeCompetition assayDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsTagBFP, miRFP703, dTomatoExpressionMammalianMutationPGK, TagBFP, dTomato without BsmBI cutsiteAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-HF1
Plasmid#138556PurposeExpresses human codon-optimized high-fidelity SpCas9 and blasticidin resistance: EFS promoter-SpCas9-HF1-NLS-FLAG-P2A-BSDDepositorInsertSpCas9-HF1
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926APromoterEFSAvailable SinceJune 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-aBEST
Plasmid#131464PurposeExpression of a Streptomyces codon optimized Cas9n-tadA fusion protein in pGM1190. A to G base editor for actinomycetesDepositorInsertsStreptomyces codon optimized spCas9n (D10A)
streptomyces codon optimized tadA
UseCRISPR and Synthetic BiologyPromotertipAAvailable SinceNov. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMVS102_P3-GFP-NATMX6
Plasmid#99048PurposeEGFP reporter with six binding sites for the Zif268 DNA binding domainDepositorInsertsMcIsaac 2014 P3 promoter
eGFP
clonNAT resistance
ExpressionYeastMutationGAL1 promoter with 4 GAL4 sites removed and repla…PromoterMcIsaac 2014 P3 promoterAvailable SinceJan. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EFS-foldon-GFP- PCP
Plasmid#194503PurposeExpression foldon-GFP-PCP protein for imaging of nonrepetitive DNADepositorInsertfoldon-GFP-PCP
UseLentiviralExpressionMammalianPromoterEF-1α core promoterAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131-STU-Lb
Plasmid#138096PurposeGolden Gate entry vector for 1st crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134-STU-Lb
Plasmid#138105PurposeGolden Gate entry vector for 4th crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133-STU-Lb
Plasmid#138102PurposeGolden Gate entry vector for 3rd crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132-STU-Lb
Plasmid#138099PurposeGolden Gate entry vector for 2nd crRNA cloning with LbCas12a crRNA scaffold flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ144-ZmUbi-pT
Plasmid#138108PurposeGolden Gate recipient and Gateway entry vector; assembly of 4 gRNAs driven by Zea mays Ubi promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ142-ZmUbi
Plasmid#138106PurposeGolden Gate recipient and Gateway entry vector; assembly of 2 gRNAs driven by Zea mays Ubi promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS-GFP(ATG mut)
Plasmid#197885PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre and the leakage expression is significantly reduced without CreDepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPSt_35Spr-GFP-t35S
Plasmid#203592PurposeFully assembled Plant STARR-seq plasmid with the 35S terminator.DepositorInsertsCaMV 35S promoter + Zm00001d041672 5'UTR
eGFP
CaMV 35S terminator
ExpressionPlantAvailable SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSL1425 (pSPIN, pCDF backbone)
Plasmid#160735PurposeSingle-plasmid V. cholerae CAST system, encodes all proteins, crRNA, and donor DNA. Entry vector encodes non-targeting crRNA and has BsaI sites for spacer cloning. pCDF backbone.DepositorInsertVchCAST proteins, crRNA, and donor DNA
ExpressionBacterialPromoterJ23119Available SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
VP12
Plasmid#72247PurposeHuman expression plasmid for SpCas9-HF1 variant: CMV-T7-humanSpCas9-HF1(N497A, R661A, Q695A, Q926A)-NLS-3xFLAGDepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 HF1(N497A/R661A/Q695A/Q926A)-NLS-3xFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A and Q926APromoterCMVAvailable SinceJan. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eNme2-C-ABE8e
Plasmid#185667PurposeExpresses eNme2-C-ABE8e in mammalian cellsDepositorInsertecTadA(8e)-neNme2-C
UseCRISPRExpressionMammalianMutationNme2Cas9 P6S/D16A/E33G/K104T/D152A/F260L/A263T/A3…Available SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only