We narrowed to 14,178 results for: cas9
-
Plasmid#195021PurposeSequence specific sgRNA that guide Cas9 to the genomic region encoding the bovine Creb5 DNA binding domainDepositorAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pCZGY2727
Plasmid#193330PurposeSite specific insertion using CRISPR/Cas9 editing of C. elegans ChrIDepositorInsertHygromycin resistance
ExpressionWormPromoterPrps-0Available SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-ECT2
Plasmid#183835PurposeRepair template for the N-terminal tagging of Ect2 with mNeonGreen in human cells using CRISPR/Cas9.DepositorInsertECT2 homology arms with mNeonGreen-linker (ECT2 Human)
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9337 (pgRNA_IV-1_NatMX)
Plasmid#161590PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site IV-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTJV1ScKm-rpoB
Plasmid#166980PurposeGenerates ssDNA in vivo targeting E. coli rpoB for recombineering w/ Beta recombinase; temp. sensitive pSC101 ori and sgRNA for Cas9 counterselection; npt2 for kanamycin resistanceDepositorInsertNeoR/KanR
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgGPT2_9
Plasmid#163456Purposelentiviral vector expressing Cas9 and an sgRNA targeting GPT2DepositorInsertsgRNA 9 targeting GPT2 (GPT2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - Amplicon, BCR/ABL sgRNA 1
Plasmid#70659PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an intergenic BCR/ABL-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against BCR/ABLamplicon found in CML-derived K562 cell line
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDGE168
Plasmid#79458Purposerecipient plasmid [multiplexing]; pDD45:Cas9, FAST, HygroDepositorAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-eVRQR-P2A-EGFP (KAC1028)
Plasmid#242663PurposeCMV promoter expression plasmid for human codon optimized SpCas9-eVRQR(S55R)-BPNLS(SV40)-3xFLAG-P2A-EGFPDepositorInsertpCMV-SpCas9-eVRQR(S55R)-BPNLS(SV40)-3xFLAG-P2A-EGFP
UseCRISPRTagsBPNLSExpressionMammalianMutationeVRQR mutations in SpCas9(S55R/D1135V/G1218R/R133…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2-SpG (HES824)
Plasmid#242689PurposePrime editing in mammalian cells with SpG-based PE2 prime editorsDepositorInsertpCMV-NLS-SpCas9(H840A)-M-MLV-RT(D200N,T306K,W313F,T330P,L603W)-NLS
UseCRISPRTagsNLSExpressionMammalianMutationPE2 mutations in MMLV RT, SpG mutations in SpCas9…PromoterCMVAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSG1017-2xBsaI-SaKKH-2xUGI_P2A_EGFP
Plasmid#239450PurposeCodon-optimized S. aureus KKH Cas9 with 2x UGI. 2x BsaI sites for easy cloning of varying deaminases for cytosine base editing. EGFP can serve as a transfection marker.DepositorTypeEmpty backboneUseCRISPRTagsEGFPExpressionMammalianPromoterCMVAvailable SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRVV653
Plasmid#89474PurposeDonor vector for creation of CRISPR/Cas9-mediated Bxb1 attP-flanked alleles.DepositorInsertBxb1 attP
UseCRISPRAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRVV598
Plasmid#87629PurposeDonor vector for creation of CRISPR/Cas9-mediated Bxb1 attP-flanked alleles.DepositorInsertBxb1 attP
UseCRISPRAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T_CDC45-HaloTag
Plasmid#244244PurposeCRISPR/Cas9 donor plasmid to tag human CDC45 with Halo tagDepositorAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT03
Plasmid#223375PurposeT-DNA vector for SpCas9 mediated mutagenesis for dicot plants; NGG PAM; Cas9 was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-PGAM1_sgRNA1
Plasmid#201614PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPGAM1 (PGAM1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-HK2_sgRNA2
Plasmid#201597PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertHK2 (HK2 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1 sgTollip
Plasmid#196546PurposeLentiviral CRISPR-Cas9 plasmid containing gRNA targeting exon 1 of human Tollip. Used for generation of Tollip protein knockouts in human cell lines.DepositorAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
px335-EF-Slc2a3-L
Plasmid#122304PurposeExpresses sgRNA targeting mouse Slc2a3 and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Slc2a3 (Slc2a3 Synthetic)
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only