We narrowed to 14,475 results for: cas9 genes
-
Plasmid#171143PurposeExpression of Sp.pCas9-dCas9 and BBa_J23107-MCP-SoxS(R93A/S101A) on pRK2-KmR plasmidDepositorInsertSp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterSp.pCas9, BBa_J23107Available SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPPC002
Plasmid#171139PurposeFor integration of J1-J23117-sfGFP, Sp.pCas9-dCas9, and BBa_J23107-MCP-SoxS(R93A/S101A) with miniTn7T methodDepositorInsertsJ1-BBa_J23117-sfGFP
Sp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterJ1-BBa_J23117 and Sp.pCas9, BBa_J23107Available SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPPC010.AAV
Plasmid#171175PurposeExpression of Sp.pCas9-dCas9, BBa_J23107-MCP-SoxS(R93A/S101A), and hAAVS1 scRNA on pBBR1-KmR plasmidDepositorInsertshAAVS1 scRNA
Sp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterBBa_J23119 and Sp.pCas9, BBa_J23107Available SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGG431
Plasmid#165615PurposeVector for expression of SpCas9 in yeast after assembly with PID fragments: TEF1p-SpCas9::KanR-1xNLS-CYC1t (KanR cassette in place of the PID)DepositorInsertTEF1p-SpCas9::KanR(in place of PID)-1xNLS-CYC1t (S. cerevisiae TEF promoter driving SpCas9 with KanR cassette replacing PID)
UseCRISPRTagsSV40 NLSExpressionYeastMutationCorrected homology relative to wild type SpCas9 (…PromoterTEF1Available SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX459v3
Plasmid#178799PurposeSpCas9 with 2A-Puro, and a golden gate cloning backbone for sgRNA. sgRNA scaffold seqeuence has been modified for increased sgRNA expression (v3).DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCbh (Cas9-2A Puro) and U6 (gRNA)Available SinceAug. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGG442
Plasmid#165616PurposeVector for expression of SpCas9-Zif268 in yeast after assembly with PID fragments: TEF1p-SpCas9::KanR-1xNLS-3xHA-1xNLS-Zif268-1xNLS-CYC1t (KanR cassette in place of the PID)DepositorInsertTEF1p-SpCas9::KanR(in place of PID)-1xNLS-3xHA-1xNLS-Zif268-1xNLS-CYC1t
UseCRISPRTags3x HA, SV40 NLS, Zif268, and c-Myc-like NLSExpressionYeastMutationCorrected homology relative to wild type SpCas9 (…PromoterTEF1Available SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLY70
Plasmid#130948PurposeA CRISPR activation device with the necessary genes (dxcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter PrhaB), and the reporter part (PpspA-LEA3B3 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
rhaS
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterPcon, PpspA-LEA3B3, PrhaB, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY61
Plasmid#130928PurposeA CRISPR activation device with the necessary genes (dxcas9 3.7 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA1B1 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterAnderson promoter: J23106, PpspA-LEA1B1, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgSHOC2-1
Plasmid#86128PurposeLentiviral vector expressing Cas9 and an sgRNA targeting SHOC2DepositorAvailable SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgSHOC2-2
Plasmid#86129PurposeLentiviral vector expressing Cas9 and an sgRNA targeting SHOC2DepositorAvailable SinceMay 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC1orf27-1
Plasmid#86130PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C1orf27DepositorInsertsgRNA 1 targeting C1orf27 (C1orf27 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgC1orf27-2
Plasmid#86131PurposeLentiviral vector expressing Cas9 and an sgRNA targeting C1orf27DepositorInsertsgRNA 2 targeting C1orf27 (C1orf27 )
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pY108 (lenti-AsCpf1)
Plasmid#84739PurposeLenti virus delivery of AsCpf1 and crRNA guideDepositorInsertshuAsCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pY109 (lenti-LbCpf1)
Plasmid#84740PurposeLenti virus delivery of LbCpf1 and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only