We narrowed to 16,448 results for: GRN
-
Plasmid#120974PurposeMoClo golden gate assembly CD part for dCas9 (Catalytically-inactive S. pyogenes Cas9, for gRNA-targeted repression). Please see Supplemental Documents for annotated Genbank file.DepositorInsertdCas9
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR_Wheat_live_Cas9
Plasmid#126880PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and BpiI sites for sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shGFP
Plasmid#110421PurposeshGFP control, silence GFP gene, doxycycline inducible, puromycin selectionDepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pADsacA
Plasmid#158649PurposeConstitutive transcription of sacA crRNA and GFPDepositorInsertsacA crRNA
UseCRISPR and Synthetic Biology; Shuttle vector baci…ExpressionBacterialPromoterPvegAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHTganA-Cpf1
Plasmid#158647PurposeConstitutive transcription of FnCpf1 and ganA crRNADepositorInsertCpf1, ganA crRNA
UseCRISPR and Synthetic Biology; Shuttle vector baci…ExpressionBacterialPromoterP43Available SinceOct. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shLuc
Plasmid#110422PurposeshLuc control, silence Luc gene, doxycycline inducible, puromycin selectionDepositorInsertLuciferase
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVX-H3.3-G34R-FLAG-BFP
Plasmid#209440PurposeLentiviral packagable plasmid expressing FLAGGED human histone mutant H3.3-G34R with BFPDepositorInsertH3.3-G34R
ExpressionMammalianMutationG34RAvailable SinceNov. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
BII-gR-PnTW
Plasmid#133356PurposePiggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications) coexpressed with tdTomato-NLSDepositorInserttdTomato-NLS
TagsHA-tagged tdTomatoExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1B
Plasmid#185383PurposeFor mammalian expression of shRNA: GAGCAGAAGAGGATGAATTTA that targets human PPM1BDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
cTRE-GFP-miR30_shPten.1523
Plasmid#135667PurposeIntroduce Dox-inducible (TRE promoter) GFP cDNA plus miR30-embedded shPten into (ES) cells by recombination-mediated cassette exchangeDepositorInsertshPten
UseMouse TargetingAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
CRISPR plasmid
Plasmid#236553PurposeEncodes Cas9 and two guideRNAs, one to cut the genome downstream of HSPA5 (BiP/GRP78) and one to linearize the DONOR plasmid.DepositorInsertCas9
ExpressionMammalianAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pPATZ1.1.0-gDNA
Plasmid#132476PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertPATZ1 (PATZ1 Human)
UseCRISPRAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRARB.1.0-gDNA
Plasmid#132471PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertRARB (RARB Human)
UseCRISPRAvailable SinceDec. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF302.1.0-gDNA
Plasmid#132467PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF302 (ZNF302 Human)
UseCRISPRAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZFPM2.1.0-gDNA
Plasmid#132459PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZFPM2 (ZFPM2 Human)
UseCRISPRAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiCROP-PuroR-P2A-GFP-U6
Plasmid#200029PurposeLentiviral CROP-seq vector backbone with PuroR-P2A-GFP for cloning DNA Ticker Tapes and U6 for pegRNAsDepositorTypeEmpty backboneUseLentiviralTagsPuroR-P2A-GFPExpressionMammalianAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shATF4 #2
Plasmid#242703PurposeshRNA knockdown human ATF4 geneDepositorInsertATF4 (ATF4 Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only