We narrowed to 13,191 results for: BASE

#171695

Expresses nSaCas9 in mammalian cells

Jia Chen

Wang et al Nat Cell Biol. 2021 May 10. pii: 10.1038

Aug. 9, 2021

Academic Institutions and Nonprofits only

#97319

HMEJ donor for fusing a p2A-mCherry reporter to mouse Cdx2. AAV backbone.

Hui Yang

Yao et al Cell Res. 2017 May 19. doi: 10.1038/cr.2

Aug. 2, 2017

Academic Institutions and Nonprofits only

#87403

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87404

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87382

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87384

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#231812

N-terminally sYFP-tagged Arrestin3

Moritz Bünemann

Kirchhofer et al Commun Biol. 2025 Feb 8;8(1):198. doi: 1

Jan. 6, 2026

Academic Institutions and Nonprofits only

#235448

Helper plasmid with sfGFP gene inserted at gene VIII locus

Yolanda Schaerli

Kusumawardhani et al Nat Commun. 2025 Apr 15;16(1):3569. doi:

Nov. 18, 2025

Academic Institutions and Nonprofits only

#240973

To endogenously tag S. cerevisiae proteins at their C-terminus with Pho8∆60; HphMX6 selection marker

Fulvio Reggiori

Valdbjorn Kanne et al Autophagy Rep. 2025 May 31;4(1):2511724.

Nov. 18, 2025

Academic Institutions and Nonprofits only

#230073

Constitutive expression Promoter (RpoD sigma factor, BT_RS06635), integrates via IntN1; N-/C-terminal iLOV fusion, ermF, C-terminal 3x-FLAG, R6K ori, RP4 oriT

Sean Crosson

Schnizlein et al Microbiol Resour Announc. 2025 May 8;14(

June 23, 2025

Academic Institutions and Nonprofits only