We narrowed to 24,950 results for: Spr
-
Plasmid#159290PurposeLentiviral vector expressing gRNA targeting KAT6A (gRNA ID. A8)DepositorInsertguide RNA targeting KAT6A (ID. A8) (KAT6A Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6 promoterAvailable SinceNov. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(gKAT6A-A7)-PGKpuro2ABFP-W
Plasmid#159289PurposeLentiviral vector expressing gRNA targeting KAT6A (gRNA ID. A7)DepositorInsertguide RNA targeting KAT6A (ID. A7) (KAT6A Human)
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6 promoterAvailable SinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCC_11 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-KRAB-dxCas9-NLS-2A-Puro-WPRE
Plasmid#139096PurposeExpresses human codon-optimized inactive xCas9 3.7 fused to a transcriptional repressor KRAB in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a barcode downstream of sgRNA cassette.DepositorInsertKRAB-dxCas9 3.7
UseCRISPR and LentiviralExpressionMammalianMutationD10A, H840A, A262T, R324L,S409I, E480K, E543D, M6…Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP324-pAAV-FullH1TO-SaCa9sgRNAi(emx1sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113701PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP322-pAAV-FullU6TO-SaCa9sgRNAi(emx1-sg1)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113699PurposeDox-inducible U6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDY0423 Cargo EGFP with AttP Bxb1 site for in-frame fusion (Parent minicircle)
Plasmid#179116PurposeCargo EGFP with AttP Bxb1 site for in-frame fusion (Parent minicircle)DepositorInsertCargo EGFP with AttP Bxb1 site for in-frame fusion
UseCRISPRAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYJA5
Plasmid#217778PurposeThe empty vector for quadruple sgRNA cloningDepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsPuromycin resistance gene, T2A, and TagBFPExpressionMammalianPromoterPGK, CMV, U6Available SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-enAsCas12a(E174R/S542R/K548R)-NLS(nuc)-3xHA (AAS848)
Plasmid#107941PurposeMammalian expression plasmid for human codon optimized enAsCas12a (enhanced AsCas12a) encoding E174R/S542R/K548R substitutionsDepositorInserthuman codon optimized enAsCas12a (E174R/S542R/K548R)
Tags3x HA and NLS (nucleoplasmin)ExpressionMammalianMutationE174R, S542R and K548RPromoterCAGAvailable SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJEP321-pAAV-FullU6TO-SaCas9gRNAi(SapI)-CMV-TetR-P2A-GFP-KASH-WPRE-shortPA Empty Cassette
Plasmid#113698PurposeDox-inducible U6 SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDY0181 Cargo EGFP with AttP Bxb1 site (Parent minicircle)
Plasmid#179115PurposeCargo EGFP with AttP Bxb1 site (Parent minicircle)DepositorInsertCargo EGFP with AttP Bxb1 site
UseCRISPRAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(BbsI)-PGKpuro2AmCherry-W
Plasmid#67977PurposeCRISPR gRNA expression vector with an improved scaffold and puro/mCherry markersDepositorInsertU6gRNA cassette, PGKpuro2AmCherry cassette, WPRE
UseLentiviralMutationDeleted BbsI site within WPREPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-UbC-Tet1v4-dCas9
Plasmid#232180PurposeTet1v4-dCas9 from Nuñez et al. 2021, in a lentiviral cassette with blasticidin resistance, for expression in mammalian cellsDepositorInsertTet1 catalytic domain - XTEN80 linker - dead Cas9 - 2A - BlastR (TET1 Human, S. pyogenes)
UseLentiviralTagsFLAGExpressionMammalianMutationD10A, H840APromoterhUbCAvailable SinceMarch 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETM6-G6-vioABE-4A6-vioC-3A2-vioD
Plasmid#73440PurposeViolacein pathway (vioABECD) in monocistronic configuration, transcriptionally driven by orthogonal T7-lac promoter variants G6 (vioABE), 4A6 (vioC), and 3A2 (vioD) for orthogonal flux redirection.DepositorInsertPG6-vioABE-P4A6-vioC-P3A2-vioD
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPG6, P4A6, and P3A2 (orthogonal T7-lac variants)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
hu6 HGPS sgRNA expression and ABE7.10max VRQR lentiviral plasmid
Plasmid#154429Purposehu6 HGPS sgRNA expression and ABE7.10max VRQR lentiviral plasmidDepositorInserthu6 HGPS sgRNA expression and ABE7.10max VRQR lentiviral plasmid
UseCRISPR and LentiviralExpressionMammalianMutationVRQR point mutations in SpCas9Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Empty)-PGKmCherry2AGFP-W
Plasmid#67981PurposeCas9 activity reporter (control) with mCherry and GFPDepositorInsertU6gRNA cassette, PGKmCherry2AGFP cassette, WPRE
UseCRISPR and LentiviralMutationDeleted BbsI site within WPREAvailable SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-dCas9-KRAB(Kox1)-MeCP2-P2A-EGFP
Plasmid#188902PurposedCas9 with a C-term NLS-KRAB(Kox1)-MeCP2 fusion (no linker), and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertdCas9-KRAB(Kox1)-MeCP2
UseLentiviralTagsNLS-KRAB(Kox1)-MeCP2 fusion (no linker) and P2A-G…PromoterSFFVAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-dgRNA-CAG-MPH
Plasmid#106259PurposeExpresses MPH co-activator from the CAG promoter and one U6-driven dgRNA in AAV backboneDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110)
Plasmid#71707PurposeA human codon-optimized SpCas9 fused to first 110 amino acids of human GEMININ and chimeric guide RNA expression plasmidDepositorInserthumanized S. pyogenes Cas9 fused to human Geminin (GMNN Human)
UseCRISPRTags3xFLAG and hGEM(1/110)ExpressionMammalianPromoterCBhAvailable SinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits only