We narrowed to 7,880 results for: Lif
-
Plasmid#118723PurposeThe donor only (YPet(short)) control for the FL-based human desmoplakin II tension sensor provides the donor only lifetime used in fluorescence lifetime measurements to determine FRET.DepositorInserthuman Desmoplakin II-[YPet(short)-FL-mCherry(Y72L)] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)-FL-mCherry(Y72L)ExpressionMammalianMutationinserted FL-based tension sensor module after aa1…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLCV2-CDK12(hU6-sg2-mU6-sg3)-Blast
Plasmid#208344PurposepLentiCRISPRv2-Blast backbone with two separate sgRNAs against CDK12DepositorArticleAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCR8-CDK12(sgR)
Plasmid#208346PurposeGateway cloning entry vector with CDK12 with sgRNA resistant silent mutations. Must be recombined into a DEST vector for expression.DepositorArticleInsertcyclin dependent kinase 12 (CDK12 Human)
UseGateway: entry vectorMutationSilent mutations in A88, K90, D92, R94, T715, S71…Available SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLCV2-CDK13(hU6-sg2-mU6-sg3)-Blast
Plasmid#208348PurposepLentiCRISPRv2-Blast backbone with two separate sgRNAs against CDK13DepositorArticleAvailable SinceJan. 29, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-PGC-1alpha-IRES-mCitrine
Plasmid#241791PurposeExpression vector for mouse Pgc-1alpha with mCitrineDepositorAvailable SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Tre-Rac1-P29S (FLARE)
Plasmid#241371PurposeDox-inducible expression of Rac1-P29S FLARE sensorDepositorUseLentiviralTagsYPet (N terminal to Pak1) and mCerulean3 (N termi…MutationP29S in Rac1PromoterTREAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-FLEX-CAG_G-PTEN
Plasmid#227438PurposeAn AAV backbone for expression of the G-PTEN sensor under the CAG promoter, in a Cre dependent manner.DepositorInsertG-PTEN sensor (Pten Rat)
UseAAVTagsCD-sREACh and mEGFPExpressionMammalianMutationR14GPromoterpCAGAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-NIL
Plasmid#233154PurposeRetroviral expression of Ngn2, Isl1, and Lhx3 for motor neuron reprogrammingDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRetroQ-GTSE1-acGFP-S91, 262, 454, 724A
Plasmid#224741PurposeRetroviral vector for delivery and expression of acGFP1-tagged GTSE1 protein with S91, 262, 454, 724A mutationDepositorInsertGTSE1 (GTSE1 Human)
UseRetroviralTagsacGFPMutationSerine 91, 262, 454, 724 to AlaninePromoterCMVAvailable SinceDec. 23, 2024AvailabilityAcademic Institutions and Nonprofits only